December 2003 - cypherpunks-legacy

Re: [LONG, off-topic]] Interactive Programming (fwd)
by Brandon Crosby 17 Dec '03

17 Dec '03

> > LISP programmers are much more into writing programs which > > build and execute routines on the fly. > > As are some perl programmers. As both a perl programmer and a lisp > programer I have never had the need to use self modifing code. In fact I > would consider haveing to use s-m code as a sine that I have made a > mistate in my desinge. > PERL is a pretty high-level language... how do you add sub's after running the code? -Brandon Crosby

3 2

RE: One-Way Functions
by Ian Clysdale 17 Dec '03

17 Dec '03

Yes, there are a number of other one-way functions. The Diffie-Hellman algorithm relies on the difficulty in taking logarithms versus finding an exponent. Elliptic-curve cryptography relies on some rather complicated group theory. Look either of those up to find out some more information. If you're interested in learning about this kind of stuff, I HIGHLY recommend Bruce Schneier's Applied Cryptography. Another good book is the Handbook of Applied Cryptography by Paul Van Oorschot, Alfred Menenzes and Scott Vanstone. ian >---------- >From: semprini@theschool.com[SMTP:semprini@theschool.com] >Sent: Monday, October 20, 1997 4:04 AM >To: cypherpunks(a)toad.com >Subject: One-Way Functions > >I've read tons about how DES, PGP, and all of those programs use a >one-way function involves the difficulty of factoring out numbers. >Are there other one-way functions? > >--Dylan >

1 0

How Fast Is your System?
by Robert Hettinga 17 Dec '03

17 Dec '03

--- begin forwarded text X-Sender: fm(a)mail.espace.net Mime-Version: 1.0 Date: Mon, 20 Oct 1997 10:52:46 +0100 To: usual(a)espace.net From: Fearghas McKay <fm(a)espace.net> Subject: How Fast Is your System? Sender: <usual(a)espace.net> Precedence: Bulk List-Software: LetterRip 2.0.1 by Fog City Software, Inc. List-Subscribe: <mailto:requests@espace.net?subject=subscribe%20usual> List-Unsubscribe: <mailto:requests@espace.net?subject=unsubscribe%20usual> Status: U --- begin forwarded text How Fast Is your System? Project RC5 is an attempt to beat the RSA Secret-Key Challenge by using desktop computers to plug away at possible solutions in their spare processor time. One nifty side effect of all these boxes attempting the same process is an accurate comparison of true processor speeds. The compiled statistics show clearly what is often overlooked: not all megahertzes are created equal. A 180-MHz Pentium Pro ranges from 413 kk/s (thousand keys per second) running Windows 95 to 461 kk/s under Linux. In comparison, 180-MHz Macs range from 434 kk/s (a Motorola machine with a 603e chip running MacOS 7.6.1) to 530 kk/s (a Motorola 604e with MacOS 8). That's a significant difference. The fastest single-processor computer is a Power Mac 9600/350, with a 350-Mhz PowerPC 604e chip, that slices through 1012 kk/s. Check these stats out and compare not only platforms, but operating systems, too. [Netsurfer=92s Digest] RC5: <http://www.distributed.net/rc5/>=20 RSA: <http://www.rsa.com/rsalabs/97challenge/>=20 Stats: <http://www.alde.com/speed.html> --- end forwarded text --- end forwarded text ----------------- Robert Hettinga (rah(a)shipwright.com) Philodox e$, 44 Farquhar Street, Boston, MA 02131 USA "... however it may deserve respect for its usefulness and antiquity, [predicting the end of the world] has not been found agreeable to experience." -- Edward Gibbon, 'Decline and Fall of the Roman Empire' The e$ Home Page: http://www.shipwright.com/ Ask me about FC98 in Anguilla!: <http://www.fc98.ai/>

1 0

A Beehive in their Bonnet, from The Netly News
by Declan McCullagh 17 Dec '03

17 Dec '03

*********** http://cgi.pathfinder.com/netly/opinion/0,1042,1509,00.html The Netly News (http://netlynews.com/) October 20, 1997 A Beehive in Their Bonnet by Declan McCullagh (declan(a)well.com) John Caldeira's remark in a beekeeper's discussion area on Prodigy seemed innocuous enough: It described how to rid honeybees of parasites. "Two ounces of Mavrik mixed with one gallon of water and sprayed on the bottom boards of one's hives several times a year. It is reportedly very effective," Caldeira wrote. Honey may attract flies, but this discussion about its production drew swarms of bureaucrats. The Texas Department of Agriculture charged Caldeira with violating a state law banning unapproved discussions of bee medicines and fined the 42-year-old hobbyist $600. A draft statement from the department complains that Caldeira was "criticizing regulations" and improbably argues that "the honey market in the U.S. could become depressed because of widespread concerns about its safety and due to Mr. Caldeira's suggestion that commercial beekeepers are using Mavrik in their hives." But the Texas bureaucrats have a problem: The law seems to violate the First Amendment's guarantees of freedom of speech. "There is absolutely no doubt that John Caldeira's speech is -- and should be -- protected speech under the First Amendment to the U.S. Constitution," says Mike Godwin, staff counsel to the Electronic Frontier Foundation. [...]

1 0

index.html
by Jim Choate 17 Dec '03

17 Dec '03

CNN logo Navigation Infoseek/Big Yellow Pathfinder/Warner Bros Tech banner IBM Reinventing Education rule JUSTICE SEEKS $1 MILLION A DAY CONTEMPT FINE AGAINST MICROSOFT Microsoft logo October 20, 1997 Web posted at: 1:29 p.m. EDT (1729 GMT) WASHINGTON (AP) -- The Justice Department asked a federal court Monday to hold the computer software giant Microsoft Corp. in contempt for requiring personal computer manufacturers to license and distribute its Internet browser. The department said the company violated a 1995 court order the government obtained to bar the company from anticompetitive licensing practices. The government sought a $1 million a day fine. "Microsoft is unlawfully taking advantage of its Windows monopoly to protect and extend that monopoly," Attorney General Janet Reno told reporters. Janet Reno "This is a very serious abuse," said Assistant Attorney General Joel I. Klein, head of the antitrust division. He said Microsoft's action was designed to undermine the dominant market position of its major competitor for Internet browsers, Netscape. Internet browsers are important, Klein said, because they "could erode Microsoft's operating system monopoly" in the Windows operating system. "This kind of product forcing is an abuse of monopoly power and we seek to put an end to it." Klein emphasized that the Justice Department is still investigating other practices by Microsoft but declined to give details. The Justice Department objected to Microsoft's requirement that computer manufacturers who want to license the Windows 95 operating system also license its internet browser, known as Internet Explorer. Most personal computer makers install Windows 95 at the factory. Klein said, "These are two different products." He said they should be sold as two separate products, but he adamantly said the government was not taking sides in the war for browser market share between Microsoft and Netscape, whose browser is known as Navigator, or any other company. "Each of Microsoft's products should compete on its own merits," Klein said. Copyright 1997 The Associated Press. All rights reserved. This material may not be published, broadcast, rewritten, or redistributed. _________________________________________________________________ Infoseek search ____________________ ____ ____ _________________________________________________________________ rule Watch these shows on CNN for more sci-tech stories: CNN Computer Connection | Future Watch | Science & Technology Week rule Message Boards Sound off on our message boards You said it... [INLINE] IBM Reinventing Education rule To the top © 1997 Cable News Network, Inc. All Rights Reserved. Terms under which this service is provided to you.

1 0

Re: Save Water... ask me how!
by nobody＠REPLAY.COM 17 Dec '03

17 Dec '03

martian(a)rt66.com wrote: > Ask me how to save water. > http://www.rt66.com/martian Did anyone else go there? What a smell, eh? Whoooeee. I bet that guy saves a *lot* of water. Human-Gus Peter

1 0

SMTP Encryption Extension
by mskala＠langara.csc.UVic.CA 17 Dec '03

17 Dec '03

Lots of people want to encrypt network traffic in large quantities to deter wiretapping, raise awareness, and so on. The usual approach seems to be to encrypt at a very low level, on individual network links. Unfortunately, those plans aren't moving very fast, partly because they require the involvement of people in positions of power at both ends of any given link. If I'm the sysadmin of a major ISP, I've got more important things to worry about than trying to coordinate with my counterpart at the other end of a high-speed link that is ALREADY WORKING FINE, and trying to change the protocol. Well, what are we really concerned about? Not Web traffic - although your web surfing history is private information, the data itself is by nature public and encrypting it is kinda pointless. The same kind of argument applies to news. What we're really concerned about w.r.t. wiretapping is electronic mail. So why not extend SMTP to do strong encryption? When your SMTP mailer connects to another mailer with the encryption extension, they exchange public keys, use those to exchange a session key, and encrypt their traffic. When your smart mailer connects to a stupid mailer, they just speak normal SMTP. This is a win even without any special key management: even if I can't verify that the identity of the remote SMTP server is correct, I'm still protected from passive attacks if I know that only the remote server (whoever that is) can read the traffic. If we're concerned about government surveillance of the populace, passive wiretaps are by far the most significant threat. This has the advantage that it only requires support from the admins of the computers that send and receive email; your ISP doesn't have to cooperate. Also, it doesn't require cooperation between the two ends of a connection: I can put the crypto extension onto my system without worrying about whether any other specific person will cooperate. Finally, it's got good subversive potential; the benefits of having the extension increase exponentially as more people have it. Just imagine if we could get a major Linux distribution to install it by default. Wham! All of a sudden, whenever any two boxes running that distribution connect to each other, they automatically do it securely. The ideal way to implement this would be as a patch to sendmail, but for short term "proof of concept", I'm building a Perl program that will listen on port 25, accept SMTP connections, and pass the data through to a copy of sendmail running on some other port. It also has a client side which gets installed as a "mailer" under sendmail, replacing sendmail's built-in IPC mailer. When two copies of sendmail so equipped connect to each other, they automatically encrypt. I've already got code for a program I call "blackpony", that implements the basic protocol using RSA and Blowfish (extensible to others). It also supports ROTn, in order to provide a cryptosystem people can do in their heads while manually testing the program. I haven't finished testing the integration between it and sendmail, and I'd like to document the protocol more thoroughly, but it does work, and it transparently interoperates with ordinary sendmail. I expect to have it in a form I'll be willing to show people, within the week. If anyone would like a copy or has any comments or suggestions, please let me know. Perl5 is required, as is the Cryptix security library available at http://www.systemics.com/software/. At present the Linux /dev/urandom device (or something like it) is required, but I intend to make that optional eventually. Deploy and enjoy...

1 0

Cato Institute briefing paper on domain names
by Declan McCullagh 17 Dec '03

17 Dec '03

*************** http://www.cato.org/pubs/briefs/bp-033.html INTERNET DOMAIN NAMES Privatization, Competition, and Freedom of Expression by Milton L. Mueller Milton L. Mueller, an associate professor at the Syracuse University School of Information Studies, is the author of many scholarly works on telecommunications policy. Executive Summary There is growing confusion over the administration of Internet top-level domain names (TLDs), the system of suffixes, such as .com, .org, and .edu, that determines a person's e-mail or Web site address on the Internet. We need to define rules and procedures that will permit and encourage competition among administrators of TLDs in response to market demand. Freedom of expression should be a primary concern. Proposals for compulsory national TLDs should be rejected. National TLDs would undermine the international character of the Internet and encourage national governments to enact myriad petty regulations and restrictions on free speech. Domain names should not be equated with trademarks or brand names. We should reject attempts to forge inappropriate links between domain name registration and trademark protection. The U.S. government should encourage the development of property rights and competition by moving the administration of Internet domain names into the private sector. ### ------------------------- Declan McCullagh Time Inc. The Netly News Network Washington Correspondent http://netlynews.com/

1 0

DNA encrypted messages (fwd)
by Jim Choate 17 Dec '03

17 Dec '03

Forwarded message: >From owner-traveller(a)Phaser.ShowCase.MPGN.COM Mon Oct 20 18:05:46 1997 Message-Id: <199710202034.WAA19474(a)vip.cybercity.dk> From: "Mark Seemann" <dko3835(a)vip.cybercity.dk> To: <traveller(a)MPGN.COM> Subject: DNA encrypted messages Date: Mon, 20 Oct 1997 22:28:39 +0200 X-MSMail-Priority: Normal X-Priority: 3 X-Mailer: Microsoft Internet Mail 4.70.1155 MIME-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 7bit Sender: owner-traveller(a)Phaser.ShowCase.MPGN.COM Reply-To: traveller(a)MPGN.COM Tue, 21 Oct 1997 00:08:58 +1300 Andrew Moffatt-Vallance wrote: > To crib a plot line from ST:TNG (who cribed it from Niven I think). Assuming > that the aliens have a reasonable biotech, why not encode it in the DNA > sequences of some local life forms. Sharks would be a good bet, or jellyfish. > Remember something like 90% of any DNA sequence is just waste space. I actually used this idea maybe ten adventures back in my current campaign, although I got the idea myself and thought it was pretty original. Well, that just goes to show... The setup was a little different. A psionic noble (yes, I'm playing off the Psionic Knights campaign) was persued during the psionic suppressions, and encoded the whereabouts of his (psionic) noble's order's tresuary in plasmid rings in his blood, leaving behind him a subtle clue for friendly successors to pick up. The player characters found his buried body, dug it up and analyzed what was left of his deteriorated blood. The party's (NPC) doctor found the following obviously artificial encoding as part of more 'natural' DNA: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTT AAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTT AAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTT AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT AAAAACAAGAATACAACCACGACTAGAAGCAGGAGTATAATCATGATT CAACACCAGCATCCACCCCCGCCTCGACGCCGGCGTCTACTCCTGCTT GAAGACGAGGATGCAGCCGCGAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ATAAGGCGTCTAATGGCAAAGAAGAAGACAGCACTACGCCAGCCTGAA AGGCGTATCGCACCGAGGCGTATACACATGCTAGCCGCAGAAAGGCGT CGTAGGCCTCTCGCAAGGATAATACGACGTATCCAGCCTCAAGCACTC CGAGCACAGCCGCGCATGCGTCAGAGGCCCGCAATGATCCAGATACTC GCAAGCACTGCCGCACGCAGGCTGCCCAGGCTAGCACGAATTATTCAG ATACAGAGGCCCGCACGTATGATACGACAACCTCAGCTCCAGCGACCT GCACGAATTGCACTCCACATGGCACGACGTATCATGCGTGCACGAATT GCACTCCACATGGCAGAACACCAGCTCATGGCACTACTCAGGCGTGCC GCAAGGCTCGCACTCCACATGGCAATCATGAGGATCGCACCGAGGCCT CTAGCAATTCAGCCTCAAATGCGTGCCGCAAGTCCCAGGATACCAGCA AGTCGAGACGCACTCCACCGTCGAGAACCTGCACAGCCTGCACTCCAC ATGGCAGAAATGCCCCCCGCCAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA I explained to the players that 'A' was for Adenine, 'C' for Cytocine, 'G' for Guanine, and 'T' for Tymine (the for possible DNA bases) and let them loose without any further help at all. They actually broke the code, and it was very satisfying for both them and me. Here's a little challenge for you all: Can any of you guys break the code? Mark Seemann mark(a)dk-online.dk http://www2.dk-online.dk/users/mark_seemann

1 0

Re: SMTP Encryption Extension
by Ariel Glenn 17 Dec '03

17 Dec '03

>Well, what are we really concerned about? Not Web traffic - although your >web surfing history is private information, the data itself is by nature >public and encrypting it is kinda pointless. Not at all! Most of my time is spent trying to keep 'restricted data' from being scooped by the wrong people... from the Web. We have licensed data, students' private data, surveys and voting (the results of which should be available only in certain formats and then only to certain people), etc. etc... So data kept on the filesystem has to be protected and it has to be encrypted when it is sent out to the browsing (legitimate) user. Nice try... Ariel Glenn ariel(a)columbia.edu

2 1