- cypherpunks-legacy - lists.cpunks.org

SMTP Encryption Extension
by mskala＠langara.csc.UVic.CA 17 Dec '03

17 Dec '03

Lots of people want to encrypt network traffic in large quantities to deter wiretapping, raise awareness, and so on. The usual approach seems to be to encrypt at a very low level, on individual network links. Unfortunately, those plans aren't moving very fast, partly because they require the involvement of people in positions of power at both ends of any given link. If I'm the sysadmin of a major ISP, I've got more important things to worry about than trying to coordinate with my counterpart at the other end of a high-speed link that is ALREADY WORKING FINE, and trying to change the protocol. Well, what are we really concerned about? Not Web traffic - although your web surfing history is private information, the data itself is by nature public and encrypting it is kinda pointless. The same kind of argument applies to news. What we're really concerned about w.r.t. wiretapping is electronic mail. So why not extend SMTP to do strong encryption? When your SMTP mailer connects to another mailer with the encryption extension, they exchange public keys, use those to exchange a session key, and encrypt their traffic. When your smart mailer connects to a stupid mailer, they just speak normal SMTP. This is a win even without any special key management: even if I can't verify that the identity of the remote SMTP server is correct, I'm still protected from passive attacks if I know that only the remote server (whoever that is) can read the traffic. If we're concerned about government surveillance of the populace, passive wiretaps are by far the most significant threat. This has the advantage that it only requires support from the admins of the computers that send and receive email; your ISP doesn't have to cooperate. Also, it doesn't require cooperation between the two ends of a connection: I can put the crypto extension onto my system without worrying about whether any other specific person will cooperate. Finally, it's got good subversive potential; the benefits of having the extension increase exponentially as more people have it. Just imagine if we could get a major Linux distribution to install it by default. Wham! All of a sudden, whenever any two boxes running that distribution connect to each other, they automatically do it securely. The ideal way to implement this would be as a patch to sendmail, but for short term "proof of concept", I'm building a Perl program that will listen on port 25, accept SMTP connections, and pass the data through to a copy of sendmail running on some other port. It also has a client side which gets installed as a "mailer" under sendmail, replacing sendmail's built-in IPC mailer. When two copies of sendmail so equipped connect to each other, they automatically encrypt. I've already got code for a program I call "blackpony", that implements the basic protocol using RSA and Blowfish (extensible to others). It also supports ROTn, in order to provide a cryptosystem people can do in their heads while manually testing the program. I haven't finished testing the integration between it and sendmail, and I'd like to document the protocol more thoroughly, but it does work, and it transparently interoperates with ordinary sendmail. I expect to have it in a form I'll be willing to show people, within the week. If anyone would like a copy or has any comments or suggestions, please let me know. Perl5 is required, as is the Cryptix security library available at http://www.systemics.com/software/. At present the Linux /dev/urandom device (or something like it) is required, but I intend to make that optional eventually. Deploy and enjoy...

1 0

DNA encrypted messages (fwd)
by Jim Choate 17 Dec '03

17 Dec '03

Forwarded message: >From owner-traveller(a)Phaser.ShowCase.MPGN.COM Mon Oct 20 18:05:46 1997 Message-Id: <199710202034.WAA19474(a)vip.cybercity.dk> From: "Mark Seemann" <dko3835(a)vip.cybercity.dk> To: <traveller(a)MPGN.COM> Subject: DNA encrypted messages Date: Mon, 20 Oct 1997 22:28:39 +0200 X-MSMail-Priority: Normal X-Priority: 3 X-Mailer: Microsoft Internet Mail 4.70.1155 MIME-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 7bit Sender: owner-traveller(a)Phaser.ShowCase.MPGN.COM Reply-To: traveller(a)MPGN.COM Tue, 21 Oct 1997 00:08:58 +1300 Andrew Moffatt-Vallance wrote: > To crib a plot line from ST:TNG (who cribed it from Niven I think). Assuming > that the aliens have a reasonable biotech, why not encode it in the DNA > sequences of some local life forms. Sharks would be a good bet, or jellyfish. > Remember something like 90% of any DNA sequence is just waste space. I actually used this idea maybe ten adventures back in my current campaign, although I got the idea myself and thought it was pretty original. Well, that just goes to show... The setup was a little different. A psionic noble (yes, I'm playing off the Psionic Knights campaign) was persued during the psionic suppressions, and encoded the whereabouts of his (psionic) noble's order's tresuary in plasmid rings in his blood, leaving behind him a subtle clue for friendly successors to pick up. The player characters found his buried body, dug it up and analyzed what was left of his deteriorated blood. The party's (NPC) doctor found the following obviously artificial encoding as part of more 'natural' DNA: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTT AAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTT AAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTT AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT AAAAACAAGAATACAACCACGACTAGAAGCAGGAGTATAATCATGATT CAACACCAGCATCCACCCCCGCCTCGACGCCGGCGTCTACTCCTGCTT GAAGACGAGGATGCAGCCGCGAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ATAAGGCGTCTAATGGCAAAGAAGAAGACAGCACTACGCCAGCCTGAA AGGCGTATCGCACCGAGGCGTATACACATGCTAGCCGCAGAAAGGCGT CGTAGGCCTCTCGCAAGGATAATACGACGTATCCAGCCTCAAGCACTC CGAGCACAGCCGCGCATGCGTCAGAGGCCCGCAATGATCCAGATACTC GCAAGCACTGCCGCACGCAGGCTGCCCAGGCTAGCACGAATTATTCAG ATACAGAGGCCCGCACGTATGATACGACAACCTCAGCTCCAGCGACCT GCACGAATTGCACTCCACATGGCACGACGTATCATGCGTGCACGAATT GCACTCCACATGGCAGAACACCAGCTCATGGCACTACTCAGGCGTGCC GCAAGGCTCGCACTCCACATGGCAATCATGAGGATCGCACCGAGGCCT CTAGCAATTCAGCCTCAAATGCGTGCCGCAAGTCCCAGGATACCAGCA AGTCGAGACGCACTCCACCGTCGAGAACCTGCACAGCCTGCACTCCAC ATGGCAGAAATGCCCCCCGCCAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA I explained to the players that 'A' was for Adenine, 'C' for Cytocine, 'G' for Guanine, and 'T' for Tymine (the for possible DNA bases) and let them loose without any further help at all. They actually broke the code, and it was very satisfying for both them and me. Here's a little challenge for you all: Can any of you guys break the code? Mark Seemann mark(a)dk-online.dk http://www2.dk-online.dk/users/mark_seemann

1 0

Re: A Beehive in their Bonnet, from The Netly News
by Jim Ray 17 Dec '03

17 Dec '03

-----BEGIN PGP SIGNED MESSAGE----- At 12:41 PM 10/20/97 -0400, Declan McCullagh wrote: ... >A Beehive in Their Bonnet >by Declan McCullagh (declan(a)well.com) > > John Caldeira's remark in a beekeeper's discussion > area on Prodigy seemed innocuous enough: It > described how to rid honeybees of parasites. "Two > ounces of Mavrik mixed with one gallon of water and > sprayed on the bottom boards of one's hives several > times a year. It is reportedly very effective," > Caldeira wrote. > > Honey may attract flies, but this discussion about its > production drew swarms of bureaucrats. The Texas > Department of Agriculture charged Caldeira with > violating a state law banning unapproved discussions > of bee medicines and fined the 42-year-old hobbyist > $600. A draft statement from the department > complains that Caldeira was "criticizing > regulations" and improbably argues that "the honey > market in the U.S. could become depressed because > of widespread concerns about its safety and due to > Mr. Caldeira's suggestion that commercial beekeepers > are using Mavrik in their hives." Effectively conceding that Mr. Caldeira has more reputation- capital than they do. Gee, I wonder what an enterprising bee- keeper would need to do to keep these bureaucrats at bay? ;^) Suppose that instead of "Mavrik" the solution were instead the regular burning of hemp byproducts nearby? If nothing else, this would certainly lead to docile bees... JMR -----BEGIN PGP SIGNATURE----- Version: 2.6.2 Comment: Freedom isn't Freeh. iQEPAwUBNEvklzUhsGSn1j2pAQGqqQfPV4xHkB2JIySmL7mdcNSbu9D79EVPeGPu lk448L9pQw6UgDQy6cIn6+xY4/0zwEGItf0gEPwkT7upTBKpoOJEIk7zlJPgw0H1 7WZZDARj1scqM7YVIIq5ce1c/3jMUfqTZ3HcXhxJ9rPtHmU4+PW5Y6uJisSE2fKY f3JrGhcfOfkdhGPSBNZTmtfwnBZRORXbv1aM+ibqgLcipWr7SrfyrLoE8VQr4pEd BJ7aBgoQK0cNw4f9vLcETTrPCrEsJqbRoFfl97apehp1zmSoKYn1AeriRK4qE0mD v7dY2sclypzpH59wF45mddMUO7uYdaZ7EzxDV3ll6qqEpA== =krnc -----END PGP SIGNATURE-----

1 0

Re: A Math problem related to cryptography
by phelix＠vallnet.com 17 Dec '03

17 Dec '03

On 19 Oct 1997 18:36:26 -0500, Jeffery Walker <jeff(a)beol.net> wrote: > > I have been working on some math and C++ code to implement it. The >problem relates to a possible new means of factoring. However, I have run >into a problem which I cannot solve. Indeed it maybe impossible. The >problem is this: > > Find and equation using only multiplication, division, GCD, LCM and >powers (not addition or subtraction) in terms of a and b which is equal to >a+b for all Integers. If so desired it can be assumed that a and b are >relative primes with a>b. Note that equivalent problems include but aren't >limited to finding a similar equation for a+1. If other functions such as >logs are required they may be allowed but I would have to look into it. > > To encourage people to answer I am offering $20 for a solution and >$10 for a proof that it is impossible. I will judge all answers as to the >validity both in terms of actually being correct (or in the case of a proof >a valid argument) and in that they do not use functions such as addition or >subtraction which are not allowed. > (why do I get the feeling that I'm doing somebody's homework assignment) Claim: In the realm of Integers, There does not exist a formula using only multplication,division,GCD,LCM,and powers such that f(a,b)=a+b for all integers a,b Proof (by contradiction): I assume that a,b are primes > 2. Lets also define x,y,z,w,m,n and any integer >=0 and C,D,E as any integer > 0. Now let's look at the operations available to us: multiplication and powers: C=C*(a^0)*(b^0) CD=E(a^0)*(b^0) where E=CD a=1*(a^1)*(b^0) a^2=1(a^2)*(b^0) Cab^2=C*(a^1)*(b^2) well , all results can be expressed in the following form: C*(a^x)*(b*y) division: a !| b and b !| a (here !| means "does not divide") (From here on out, lets assume that a !| C,D,E and b !| C,D,E. it makes things simpler) Ca/a=C*(a^0)*(b*0) Ca/D=E*(a^1)*(b^0) assuming that E | C I won't go through all this. It should be obvious that for all allowed divisions, the result can be expressed as C*(a^x)*(b*y) GCD: gcd(a,b)=1 gcd(a,C)=1 gcd(Ca,Da)=max(a,gcd(C,D)) gcd(Ca,Db)=gcd(C,D) gcd(C(a^x),C(a^y))=C(a^(min(x,y))) gcd(C(a^x)*(b^y),D(a^z)*(b^w))=gcd(C,D)*(a^(min(x,y)))*(b^(min(z,w)))) =E(a^m)*(b^n) for E=gcd(C,D) m=min(x,z) and n=min(y,w) so, all results of GCD can be expressed in the form: C(a^x)(b^y) LCM: LCM(C,D)=CD/gcd(C,D) LCM(C(a^x)*(b^y),D(a^z)*(b^w)) =CD*(a^(x+z))*(b^(y+w))/gcd(C(a^x)*(b^y),D(a^z)*(b^w)) =( CD/gcd(C,D) * (a^(|x+z-min(xz)|)) * (b^(y+w-min(yw)) = E(a^m)*(b^n) where E=CD/gcd(C,D)=lcm(C,D), m=x+z-min(x,z) , n=y+w-min(y,w) so, all results of LCM can be expressed in the form: C(a^x)(b^y) Now, as you can probably tell by now, I don't remember a damn thing about groups, rings, and fields. If i did, I could have done all of the above in one paragraph. SO, what I'm trying to say is that all the numbers you can operate on here will be of the form C(a^x)(b^y). SO you really have to prove at least the following C(a^x)(b^y)=a+b for some C>0, x,y>=0 integers Now, you could probably say that C=a+b, x,y=0, but that's a cop out and is probably not allowed. Now, watch while I cop out and provide an easy counterexample: assume some formula exists such that f(a,b)=a+b with f only using *,/,gcd,lcm,^ operators let a=5, b=7 Since I know that ultimately anything I do with constants and the operators 8,/,gcd,lcm,^ will result in something in the form of C(a^x)(b^y), I won't even mess with the formula there must exist some C>0, x,y>=0 that makes: C(5^x)(7^y)=5+7=12 of x>=1 and y>=1 then C(5^x)(7^y)>12 for all C>0 if x=0 and y=0, C=12 (this works) if x=1,y=0 then 5C=12. there is no C which satisfies this. if x=0,y=1 then 7C=12. there is no C which satisfies this. so, the only solution is C=12, or more generally, C=a+b oops, that can't be the formula since we're not allowed to do that. QED. Well, that was pretty sloppy, so lets be more general about this: C(a^x)(b^y)=a+b Now, I'm sure that somewhere in the history of mathematics somebody has proven that for primes a and b where a,b>2 that a*b>a+b. So, for any x,y,C>0, C(a^x)(b^y)>a+b. C, of course, cannot be negative, or zero, so all were left with is x or y being zero. Let y=0. we have: C*a^x=a+b C*a^x - a = b a*(C*a^(x-1) - 1 ) = b a*E=b Now, a and b are primes and a!=b. From the fundamental theorem of algebra, every number can be represented by a series of primes such as: p1^a1 * p2^a2 * p3^a3 * ... In a*E=b, if we factor each side down to its primes, we find that the right hand side does not contain the prime 'a' which is on the left hand side, so a*E != b. A similar argument can be used for the case x=0. This leaves the only solution to C(a^x)(b^y)=a+b being x=0,y=0 C(a^0)(b^0)=C=a+b which isn't allowed. QED Now, If you're like me, you've probably read the above and don't have a f*cking clue what I meant (I sure wouldn't if I read all that crap). So here's the executive summary. With the operators you've defined on the number set you want to work with, no matter how complicated or crazy your formula is, I can express the result at C(a^x)(b^y). And hopefully, I've shown that C(a^x)(b^y) cannot equal a+b except in the trivial case of C=a+b (with x,y=0) which is what you don't want. >Thanks, >Jeff >P.S. I am very interested in joining the coderpunks list as I do program >and am interested in cryptography as related to programming. If someone >would be kind enough to recommend me I thank you. > I wasn't aware that you had to be invited to the coderpunks list. Just send a message to majordomo(a)toad.com with the following in the body: subscribe coderpunks -- Phelix, who really should have been able to give a better proof (especially since one of my degrees has the word 'Mathematics' on it)

1 0

Re: A Math problem related to cryptography
by phelix＠vallnet.com 17 Dec '03

17 Dec '03

On 19 Oct 1997 18:36:26 -0500, Jeffery Walker <jeff(a)beol.net> wrote: > > I have been working on some math and C++ code to implement it. The >problem relates to a possible new means of factoring. However, I have run >into a problem which I cannot solve. Indeed it maybe impossible. The >problem is this: > > Find and equation using only multiplication, division, GCD, LCM and >powers (not addition or subtraction) in terms of a and b which is equal to >a+b for all Integers. If so desired it can be assumed that a and b are >relative primes with a>b. Note that equivalent problems include but aren't >limited to finding a similar equation for a+1. If other functions such as >logs are required they may be allowed but I would have to look into it. > > To encourage people to answer I am offering $20 for a solution and >$10 for a proof that it is impossible. I will judge all answers as to the >validity both in terms of actually being correct (or in the case of a proof >a valid argument) and in that they do not use functions such as addition or >subtraction which are not allowed. > (why do I get the feeling that I'm doing somebody's homework assignment) Claim: In the realm of Integers, There does not exist a formula using only multplication,division,GCD,LCM,and powers such that f(a,b)=a+b for all integers a,b Proof (by contradiction): I assume that a,b are primes > 2. Lets also define x,y,z,w,m,n and any integer >=0 and C,D,E as any integer > 0. Now let's look at the operations available to us: multiplication and powers: C=C*(a^0)*(b^0) CD=E(a^0)*(b^0) where E=CD a=1*(a^1)*(b^0) a^2=1(a^2)*(b^0) Cab^2=C*(a^1)*(b^2) well , all results can be expressed in the following form: C*(a^x)*(b*y) division: a !| b and b !| a (here !| means "does not divide") (From here on out, lets assume that a !| C,D,E and b !| C,D,E. it makes things simpler) Ca/a=C*(a^0)*(b*0) Ca/D=E*(a^1)*(b^0) assuming that E | C I won't go through all this. It should be obvious that for all allowed divisions, the result can be expressed as C*(a^x)*(b*y) GCD: gcd(a,b)=1 gcd(a,C)=1 gcd(Ca,Da)=max(a,gcd(C,D)) gcd(Ca,Db)=gcd(C,D) gcd(C(a^x),C(a^y))=C(a^(min(x,y))) gcd(C(a^x)*(b^y),D(a^z)*(b^w))=gcd(C,D)*(a^(min(x,y)))*(b^(min(z,w)))) =E(a^m)*(b^n) for E=gcd(C,D) m=min(x,z) and n=min(y,w) so, all results of GCD can be expressed in the form: C(a^x)(b^y) LCM: LCM(C,D)=CD/gcd(C,D) LCM(C(a^x)*(b^y),D(a^z)*(b^w)) =CD*(a^(x+z))*(b^(y+w))/gcd(C(a^x)*(b^y),D(a^z)*(b^w)) =( CD/gcd(C,D) * (a^(|x+z-min(xz)|)) * (b^(y+w-min(yw)) = E(a^m)*(b^n) where E=CD/gcd(C,D)=lcm(C,D), m=x+z-min(x,z) , n=y+w-min(y,w) so, all results of LCM can be expressed in the form: C(a^x)(b^y) Now, as you can probably tell by now, I don't remember a damn thing about groups, rings, and fields. If i did, I could have done all of the above in one paragraph. SO, what I'm trying to say is that all the numbers you can operate on here will be of the form C(a^x)(b^y). SO you really have to prove at least the following C(a^x)(b^y)=a+b for some C>0, x,y>=0 integers Now, you could probably say that C=a+b, x,y=0, but that's a cop out and is probably not allowed. Now, watch while I cop out and provide an easy counterexample: assume some formula exists such that f(a,b)=a+b with f only using *,/,gcd,lcm,^ operators let a=5, b=7 Since I know that ultimately anything I do with constants and the operators 8,/,gcd,lcm,^ will result in something in the form of C(a^x)(b^y), I won't even mess with the formula there must exist some C>0, x,y>=0 that makes: C(5^x)(7^y)=5+7=12 of x>=1 and y>=1 then C(5^x)(7^y)>12 for all C>0 if x=0 and y=0, C=12 (this works) if x=1,y=0 then 5C=12. there is no C which satisfies this. if x=0,y=1 then 7C=12. there is no C which satisfies this. so, the only solution is C=12, or more generally, C=a+b oops, that can't be the formula since we're not allowed to do that. QED. Well, that was pretty sloppy, so lets be more general about this: C(a^x)(b^y)=a+b Now, I'm sure that somewhere in the history of mathematics somebody has proven that for primes a and b where a,b>2 that a*b>a+b. So, for any x,y,C>0, C(a^x)(b^y)>a+b. C, of course, cannot be negative, or zero, so all were left with is x or y being zero. Let y=0. we have: C*a^x=a+b C*a^x - a = b a*(C*a^(x-1) - 1 ) = b a*E=b Now, a and b are primes and a!=b. From the fundamental theorem of algebra, every number can be represented by a series of primes such as: p1^a1 * p2^a2 * p3^a3 * ... In a*E=b, if we factor each side down to its primes, we find that the right hand side does not contain the prime 'a' which is on the left hand side, so a*E != b. A similar argument can be used for the case x=0. This leaves the only solution to C(a^x)(b^y)=a+b being x=0,y=0 C(a^0)(b^0)=C=a+b which isn't allowed. QED Now, If you're like me, you've probably read the above and don't have a f*cking clue what I meant (I sure wouldn't if I read all that crap). So here's the executive summary. With the operators you've defined on the number set you want to work with, no matter how complicated or crazy your formula is, I can express the result at C(a^x)(b^y). And hopefully, I've shown that C(a^x)(b^y) cannot equal a+b except in the trivial case of C=a+b (with x,y=0) which is what you don't want. >Thanks, >Jeff >P.S. I am very interested in joining the coderpunks list as I do program >and am interested in cryptography as related to programming. If someone >would be kind enough to recommend me I thank you. > I wasn't aware that you had to be invited to the coderpunks list. Just send a message to majordomo(a)toad.com with the following in the body: subscribe coderpunks -- Phelix, who really should have been able to give a better proof (especially since one of my degrees has the word 'Mathematics' on it)

2 1

Re: SMTP Encryption Extension
by Ariel Glenn 17 Dec '03

17 Dec '03

>Well, what are we really concerned about? Not Web traffic - although your >web surfing history is private information, the data itself is by nature >public and encrypting it is kinda pointless. Not at all! Most of my time is spent trying to keep 'restricted data' from being scooped by the wrong people... from the Web. We have licensed data, students' private data, surveys and voting (the results of which should be available only in certain formats and then only to certain people), etc. etc... So data kept on the filesystem has to be protected and it has to be encrypted when it is sent out to the browsing (legitimate) user. Nice try... Ariel Glenn ariel(a)columbia.edu

2 1

YOUR LISTING ON YAHOO!
by brian＠firstgear.com 17 Dec '03

17 Dec '03

engines, it is becoming more and more difficult to be found among the MILLIONS of listings. If you"re like the rest of us you have found it extremely frustrating. You spend lots of time and money developing your site and then you're listed number 30, or 80, or even 200th. You're NEVER FOUND. *************************** GOOD NEWS The good news is we have found a SOLUTION. After months of fighting the search engine battle we got LUCKY. A programmer recently became associated with our firm who had done some CONSULTING WORK for six months with one of the major search engines. With his help we developed a REPORT on the major search engines and how they really work. ***************************** REPORT His report is excellent. We have been using the material in the report for over five months. IT WORKS! With it, our sites are in the top TEN listings on all major search engines and we have experienced a virtual stampede of people to the web sites. HITS ARE UP, SALES ARE UP, and most importantly, everyone is HAPPY. *************************** YOUR COPY Now, YOU CAN HAVE A COPY of his report. In it you will find: How to vault in the TOP TEN on any search engine using any keyword. Strategies that put you ahead of 95% of the other sites online. How to STAY in that TOP TEN. How to improve your chances of being found in about 10 MINUTES. How the search engines calculate CONFIDENCE ratings (and what that means to you). Killer META TAGS that totally blow away your competitors. Which search engines are the very BEST FOR YOU. How to get your site REGISTERED for FREE at over 200 locations, in one easy step (it takes 10 minutes). How to BLOCK out part of your site from the search engines (and why you should do it). The effect of REPEATING KEY WORDS. (good or bad?) What happens when you repeat them too many times? LATEST FORMS for developing the best meta tags. Meta Tag strategies that can broaden your audience and build high volume web traffic for you. We tell you exactly what to do and show you SPECIFIC EXAMPLES. And it's SIMPLE and EASY to understand. So you can put the principles to immediate use. The benefits of site UPDATING. How often? What NOT to do! Avoid making those errors which can cost you. and even How to legally "steal" your competitor's web traffic and send it to your site. Type in your competitor's name and YOUR NAME will appear FIRST! *************************** WHAT DOES IT COST? The material is only $15, and is unconditionally guaranteed to work for you. Just follow the instructions and you will find your site in the top ten too. Ordering is SAFE and EASY. For more information, or to RECEIVE this 18 page report by email just go to our INSTANT-DELIVERY SECURE order form at: http://www.lr-publishing.com/SES2/ (Order on line and you will receive your report in JUST 60 SECONDS.) Now that your site is up shouldn't you take this MOST IMPORTANT LAST STEP so people can find it. ****************************** UNCONDITIONAL GUARANTEE Remember, we UNCONDITIONALLY GUARANTEE IT WORKS. You can't lose. ******************************** SPECIAL FREE BONUS Order within 48 hours, we and will include, AS A FREE BONUS, information on over 500 SEARCH ENGINES and directories where you can list your site for free. (Some are very specialized and targeted). SPECIAL NOTE: If you are busy and don't have time to go to our web site INSTANT-DELIVERY SECURE ORDER FORM, you can order by FAX. (The unconditional guarantee still applies!) Just fill in the FAX FORM AT THE BOTTOM OF THIS PAGE. Then FAX it to us at: 1-305-289-1884 If you order by FAX your copy of the report will be sent to you by email within 24 hrs. Or, if you prefer, you can send your order with a CHECK by snail mail to the address below. (Be sure to include your email address for delivery.) Whichever method you choose to order, YOU'LL BE GLAD YOU DID! Best of luck with your web site! Leeds Publishing 5800 Overseas Hwy., St. 35-154 Marathon Key, Fl. 33050 Fax 305-289-1884 http://www.lr-publishing.com/SES2/ ________________________________________________________________________ ________________________________________________________________________ FAX ORDER FORM (Please print clearly) FAX TO: Leeds Publishing FAX NUMBER: 1-305-289-1884 Hi: Here is my order for Search Engine Secrets at $15 only. I understand it is unconditionally guaranteed. Include my FREE BONUS of 500 search engines. Send by email ASAP. Date:__________________ NAME:_______________________________________________ E-MAIL ADDRESS:______________________________________________________________ (PLEASE be accurate. One small error and we can't send your order). CARD TYPE:_________________ CARD NUMBER:_________________________________________________ EXPIRATION DATE:______________ NAME ON CARD:________________________________________________ Thanks for ordering. Your copy of the report will be sent to you by email ASAP. ____________________________________________________________ ____________________________________________________________ Copyright 1997 Leeds and Rousseau Publishing. All rights reserved. Form 10-16 GD-Yahoo

1 0

I am a homosexual!@#$!@#@!!
by Bronc Buster 17 Dec '03

17 Dec '03

Hi, my name is Bronc Buster and you all know me. but what you donot know is that I AM A HOMOFAGGOT who likes lil' boys cocks and stuff. you all have to email me here cuz some body email bombed my other adress and then my new one. i also want to see pics of your cocks but please wtrie my name on your dick before you mail them to me so i know You love me. off to spank my small monkey, Bronc Buster ______________________________________________________ Get Your Private, Free Email at http://www.hotmail.com

1 0

Re: SMTP Encryption Extension
by Mike 17 Dec '03

17 Dec '03

Ariel Glenn wrote: >So data kept on the filesystem has to be protected and it has to be encrypted when it is sent out to the browsing (legitimate) user. But you can do that already with standard software. Just encrypt the disk with CFS and the web server with SSL. Nothing needs to be invented to solve your problem. All the popular browsers already have SSL running. Which leads to another idea, couldn't we encrypt SMTP by running it over SSL as a web server cgi? If 99% of Internet traffic is web browsing and we are trying to hide our email, then why not make the email look like web browsing? Just make your mailer try a "POST https" command before falling back to plain SMTP. The problem with including crypto in a popular Linux distribution is that all popular Linux distributions are from the USA. Maybe suse (www.suse.de) can change that... Mike.

3 4

Springer/Gates Merger
by nobody＠REPLAY.COM 17 Dec '03

17 Dec '03

CANADIAN NUTLY NEWS: [CNN, Bienfait, Saskatchewan] BAR OWNERS at the Coaldust Saloon, in violation of Canadian bartender/customer confidentiality laws, revealed details of a planned merger between Micro$oft and the Jerry Springer Show. Computer magnate Bill Gates has signed a secret deal with Jerry Springer to host a variety of WebTV productions which will be InterActive variations on the 'Terminal Man' theme. Springer, upset over the news media outcry over his proposed move toward bringing his Barnum & Baily act into the mainstream news forum, plans to take his revenge by using Micro$oft's domination in the lowest-common-denominator market to parlay his lack of good taste and journalistic ethics into a full-scale assasult on the elitest mainstream news media which continues to ignore the real desires of the general public. Philip R. Zimmerman, former head of PGP, Inc., announced his new position as Publicity Representative for 'New Reality Productions' by saying, "Daddy always told me, 'If you're going to sell out a little, you might as well sell out a lot--and make the BIG bucks.'" PRZ told gathered reporters that the increasing interest shown by television viewers in shows such as 'The World's Scariest Police Chases' threatened the growing popularity of the InterNet as the medium of the future. Zimmerman said, "The virtual reality of TV and the movies has always been a harbringer of the virtual future. The success of Terminal Man showed that the future was in snuff-flicks, and Police Chases was the natural movement of that theme into the trend toward Real TV." PRZ added, "The InterActive capabilities of the InterNet will allow the Gates/Springer merger to give the viewers the ability to get personally involved in the decisions as to who lives and who dies." New technologies which enable law enforcement agencies to activate kill-switches in fleeing automobiles have been abandoned in favor of technologies which allow the home viewer to use joysticks to control the movement of the criminal's vehicle and those of their police pursuers. Zimmerman defended the use of the new technology by saying, "Sure, snuff-flicks used to be illegal, but so did gambling and drinking. 'New Reality Productions' is just following the money." The beta-testing of the new technology took place on the CypherPunks mailing list, where list subscribers were given the opportunity to actively participate in the second 'moderation experiment' on the list by using their accumulated Moral Majority Reputation Credits to kill undesirable posts to the list. Chief CypherPunks Spokesperson, Jodi Hoffman, said that putting control of the list in the hands of the lowest common denominator had stemmed the "downward spiral" of the mailing list and that the Christian CypherPunks mailing list was a definite improvement over the original non-Christian-Jew infested CDR list. "Once we got rid of the Christkillers and the Commies," Hoffman proclaimed, "the list postings trickled down to two or three a day, but if it saves the life of just one child..."

1 0