December 2003 - cypherpunks-legacy

Re: Revealing individual messages.
by nobody＠REPLAY.COM 17 Dec '03

17 Dec '03

Bill Stewart wrote: > If you're concerned about Bad Cops planting forged messages on people, > this won't help - it's easy for them to forge unsigned information also. > After all, the PGP source code is open, so Bad Cops can add code to > set the timestamp/sender/etc themselves. Or they can ignore code, > and just set their system clock appropriately. BC's can also plant secret keys on your machine, along with messages forged using those keys. It is a good idea to keep badly forged messages on your machine, as well as badly forged keys. There are many ways to manipulate files and emails so that discrepancies exist. e.g. - messages with a time-stamp later than the file date; replies with an earlier time-stamp than the original message; changing fingerprint on the same key.

1 0

A Math problem related to cryptography
by Jeffery Walker 17 Dec '03

17 Dec '03

I have been working on some math and C++ code to implement it. The problem relates to a possible new means of factoring. However, I have run into a problem which I cannot solve. Indeed it maybe impossible. The problem is this: Find and equation using only multiplication, division, GCD, LCM and powers (not addition or subtraction) in terms of a and b which is equal to a+b for all Integers. If so desired it can be assumed that a and b are relative primes with a>b. Note that equivalent problems include but aren't limited to finding a similar equation for a+1. If other functions such as logs are required they may be allowed but I would have to look into it. To encourage people to answer I am offering $20 for a solution and $10 for a proof that it is impossible. I will judge all answers as to the validity both in terms of actually being correct (or in the case of a proof a valid argument) and in that they do not use functions such as addition or subtraction which are not allowed. Thanks, Jeff P.S. I am very interested in joining the coderpunks list as I do program and am interested in cryptography as related to programming. If someone would be kind enough to recommend me I thank you. +____________________________+ | Jeffery Walker | | E-mail: jeff(a)beol.net | | http://web.beol.net/jeff | +____________________________+

1 0

No Subject
by Mike Ronn 17 Dec '03

17 Dec '03

1 0

encryption key expiry in pgp5.x
by Adam Back 17 Dec '03

17 Dec '03

What happens in this scenario with pgp5.0, or pgp5.5: - You have a signature key which you'll keep for say 2 years before creating a new one. - You have a policy of generating new encryption keys every 6 months. - Your email archives are stored as received still encrypted to your public encryption key (I think you have no choice but to do this with some of the pgp5.x plugins). - You expire the key, and securely wipe the private half of the key. (An advantage of rekeying in this way is to gain forward secrecy: messages gathered by an attacker can no longer be decrypted with information you have, but to get the forward secrecy you must literally securely wipe the private key). If you do this, you won't be able to read your old mail folder, because you no longer have the key it was encrypted to. Does this imply that you must keep the private key for perpetuity? (Or at least as long as you want to read old mail archives). One presumes the same problem applies to CMR recovery keys, they must also be kept as long as recovery is required, if the user forgets the password. Adam -- Now officially an EAR violation... Have *you* exported RSA today? --> http://www.dcs.ex.ac.uk/~aba/rsa/ print pack"C*",split/\D+/,`echo "16iII*o\U@{$/=$z;[(pop,pop,unpack"H*",<> )]}\EsMsKsN0[lN*1lK[d2%Sa2/d0<X+d*lMLa^*lN%0]dsXx++lMlN/dsM0<J]dsJxp"|dc`

1 0

Re: Security flaws introduced by "other readers" in CMR
by Jean-Francois Avon 17 Dec '03

17 Dec '03

From: Fabrice Planchon <fabrice(a)math.Princeton.EDU> To: Adam Back <aba(a)dcs.ex.ac.uk> Cc: cypherpunks(a)cyberpass.net Subject: Re: Security flaws introduced by "other readers" in CMR >They do: the title is "Le programme PGP se range", which I unfortunatly > have know idea of how to translate. It can be translated by "PGP gets into the groove" it "behave itself". It finally obtemperate (wether prompted or not). It grow's up and become reasonable. "se ranger" is what you do with your car when a cop car pulls you on the side. it gets in line There is an ambiguity in this expression. "Se ranger" is usually used for a transition to an unusual or not approved behaviour to a accepted or acceptable behaviour. It entails a "higher" authority or standard. This is why I use a much more americanized language when I speak in french about civil liberties and related subjects. The french language almost equate government intentions with fatherly love... :-) Over the years, I found that most French peoples have a feodal attitude with a tendency to almost blind veneration of hierarchy. (flames to dev(a)nul.con) I suppose it comes from their History. In general, if a govt said it, it *has* to be good. It is as if they were trained since young age to surrender their capacity for independent judgment and reason. And quite distressingly, it happens even with extremely intelligent individuals. OTOH, the uncommon ones that do not exhibit such psycho-epistemological trait tend to be real hot shots, independent type. I am not French, but Canadian (french) and we often have scrapes with French on this topic. They tend to trust their govt, unless somethings warrant otherwise. Here in french Canada, we are much more American in that sense. Notwithstanding what trumped-up polls say, we have a much more american-styled opinion. Ciao JFA

1 0

Re: Security flaws introduced by "other readers" in CMR
by nobody＠REPLAY.COM 17 Dec '03

17 Dec '03

Jean-Francois Avon wrote: > From: Fabrice Planchon <fabrice(a)math.Princeton.EDU> > >They do: the title is "Le programme PGP se range", which I unfortunatly > > have know idea of how to translate. > > It can be translated by > "PGP gets into the groove" "falls in line" > it "behave itself". "obeys" > It finally obtemperate (wether prompted or not). "self-restrained" > It grow's up and become reasonable. "matures" and "conforms" > "se ranger" is what you do with your car when a cop car pulls > you on the side. it gets in line "Habeus Automobileus Recovery" > There is an ambiguity in this expression. "Se ranger" is > usually used for a transition to an unusual or not approved > behaviour to a accepted or acceptable behaviour. > It entails a "higher" authority or standard. Such as Hitler, or Freeh, or DeGaulle. There is a lot of truth to the "loose shoes, tight pussy, and a warm place to shit" school of dictatorship. As long as your butt is warm, do you really care whether 'they' are burning Jews or Jesuits to supply you with heat? Has PGP scored Joe 'White Shoes' Jackson as their SpokesPerson? VeriteMonger

1 0

your MIS email address (cosmos) may be deleted if you do not respond
by MicroServe's HELPDESK 17 Dec '03

17 Dec '03

Dear MicroServe Subscriber, The MIS accounting department is in the process of upgrading it's software. Unfortunately, they found some information missing from your account. So, we're going to need your help. Please go to the following URL (web address) with your WWW browser (Netscape, Internet Explorer, etc) and follow the online instructions. You should not have to anything except click CONTINUE once you arrive at the page. WEB URL: http://2009263:cosmos@mismail.microserve.net:235/ ACCOUNT ID: 2009263 MAILBOX: cosmos Login name: cosmos In real life: Daniel Leeds Directory: /usr5/accts/c/cosmos Shell: /usr/bin/ksh Last login Fri Jun 20 12:46 on pts001 from unknown-2-66.ra New mail received Wed Oct 15 17:05:23 1997; unread since Thu Oct 16 19:27:50 1997 PLEASE NOTE: This must be done from YOUR ppp (dial-up) account. The system will not work if you try to do this from a friend's (or any other) dial-up account. UNIX Shell customers should call (717)821-5964 extension 3 to speak with a technical support representative. Any account which still has info missing as of November 1, 1997 will be suspended (and will be deleted on November 8, 1997), as we will have to assume that the email box belongs to no one. If you have any questions, please email helpdesk(a)microserve.net. Thank You, MicroServe Engineering Department ------------------------------------------------------------------------ MicroServe Information Systems 100 North Wilkes Barre Blvd Wilkes-Barre, PA 18702

1 0

index.html
by Jim Choate 17 Dec '03

17 Dec '03

CNN logo Navigation Infoseek/Big Yellow Pathfinder/Warner Bros Tech banner IBM AS/400 rule WILL HEADLESS HUMAN CLONES GROW ORGANS IN 10 YEARS? 'Human Cloning' graphic October 19, 1997 Web posted at: 8:39 p.m. EDT (0039 GMT) LONDON (AP) -- Headless human clones will be used to grow organs and tissues for transplant surgery in the next five to 10 years, a leading authority on the ethics of human cloning predicted Sunday. Dr. Patrick Dixon, author of "The Genetic Revolution," which forecast the cloning of animals, made the prediction after The Sunday Times reported that British scientists have created a frog embryo without a head. Scientists believe the technique used to create the headless frogs could be adapted to grow human organs such as hearts, kidneys, livers and pancreases in an embryonic sac living in an artificial womb, the paper said. Many scientists believe human cloning is inevitable following the July 1996 birth of Dolly, the world's first cloned mammal. She was created at the Roslin Institute in Edinburgh using cells from a sheep's udder. "I predict that there will be great pressure to combine cloning technology with the creation of partial fetuses, missing heads, arms or legs as organ factories for tomorrow's people," Dixon told the British news agency, Press Association. "These will be developed on an experimental level somewhere in the world in countries where there is little or no gene legislation within the next 5-10 years because of the overwhelming demand," he said. "The demand is there, the technology is almost there as well," he said. Dixon called for an urgent global biotechnology summit to examine every aspect of genetics, and provide the foundations for international agreements. International inconsistencies on various aspects of genetic engineering, including human cloning, urgently need to be ironed out, he said. "Genetic engineering is a very exciting technology, it has the power to feed the world, cure disease but you do have to ask fundamental questions before it is too late," Dixon said. "The headless frog embryo is another example of the way the technology is racing far ahead of public understanding," he said. "We must get the thinking in place which looks over the horizon beyond today's headlines to what tomorrow will bring," Dixon said. "Scientists have been making up the rules as they go along." Genes manipulated to suppress frog's head Jonathan Slack, professor of developmental biology at Bath University, told The Sunday Times that he created headless frog embryos by manipulating certain genes -- and used the same technique to suppress development of a tadpole's trunk and tail as well. The headless frog embryos have not been allowed to live longer than a week because under British government rules, embryos are not considered animals until they are a week old, the paper said. Slack believes the breakthrough could be applied to human embryos because the same genes perform similar functions in both frogs and humans, The Sunday Times said. The newspaper said the lamb and frog techniques could be combined so that people needing transplants could have organs "grown to order" from their own cloned cells. These organs would exactly match the patient and there would therefore be no danger of rejection. It would also ease the shortage of organs for transplant, The Sunday Times said. Slack told the paper that using intact human embryos would not be possible because they would have to be killed. "It occurred to me a half-way house could be reached," he was quoted as saying. "Instead of growing an intact embryo, you could genetically reprogram the embryo to suppress growth in all the parts of the body except the bits you want, plus a heart and blood circulation." Growing parts of human embryos to cultivate organs could bypass many legal restrictions and ethical concerns, because without a brain or central nervous system the organisms may not technically qualify as embryos. Professor: 'No ethical issues' Lewis Wolpert, professor of biology as applied to medicine at University College London, called Slack's suggestions sensible and feasible. "There are no ethical issues because you are not doing any harm to anyone," The Sunday Times quoted him as saying. But Oxford University animal ethicist Professor Andrew Linzey told the newspaper: "It is morally regressive to create a mutant form of life." "It's scientific fascism because we would be creating other beings whose very existence would be to serve the dominant group," he was quoted as saying. Copyright 1997 The Associated Press. All rights reserved. This material may not be published, broadcast, rewritten, or redistributed. rule CNN Plus * Message Board: Cloning Health Special: Cloning Related stories: * Report: Cloned sheep has human gene - July 24, 1997 * Embryo splitting caught in cloning controversy - June 25, 1997 * Scientists grow monkeys from cloned embryos - March 2, 1997 * Firms team up to make cloned cattle with special milk - October 7, 1997 Related sites: Note: Pages will open in a new browser window * Genzyme Transgenics * Genetics and Ethics - Biomedical Ethics Unit, McGill University * Institute for Philosophy and Public Policy - Animals as Inventions: Biotechnology and Intellectual Property Rights * Genetic Engineering Home Page External sites are not endorsed by CNN Interactive. _________________________________________________________________ Infoseek search ____________________ ____ ____ _________________________________________________________________ rule Watch these shows on CNN for more sci-tech stories: CNN Computer Connection | Future Watch | Science & Technology Week rule Message Boards Sound off on our message boards You said it... [INLINE] IBM AS/400 rule To the top © 1997 Cable News Network, Inc. All Rights Reserved. Terms under which this service is provided to you.

1 0

Re: "First do no harm"
by Jean-Francois Avon 17 Dec '03

17 Dec '03

On Sun, 19 Oct 1997 16:31:10 -0700, Tim May wrote: >At 5:23 PM -0700 10/19/97, Jean-Francois Avon wrote: >First, are you reading Cypherpunks? No. I don't have time to even read all of e$ and e$pam. I am not yet retired... :-) >If so, post there. If not, please >forward my reply to the "e$" Done. >If I operated a small company, I would have no policy on this at all. Just >as I wouldn't routinely tape-record employees, I wouldn't monitor their >mail. >Do most small businesses steam open all of the incoming and outgoing paper >mail? Let me describe a scenario: one key employee isn't there because... ...he is somewhere else [ :-) ] Then, comes an urgent message forcing the company to make a split-second decision before the employee gets back. It happens _all_the_time_ in small businesses where they do not have the ressource of the big companies. You, the boss, want to re-read some critical documents before making a move. Of course, your employee was the most consciencious and trustworthy employee on this side of Andromeda, only, your memory fails as what was the *exact* wording of the critical documents. It furthermore happens that the said faithfull employee is, unknown to you and in his mind not-company-detrimental, getting intronized to the mile-high club between L.A and Tokyo in the plane lavatory, therefore not reacheable by any modern means. Wouldn't you wish you had his corporate private key? In the old days, you used to scramble through his mountain of paper on his desk. In more recent days, you frantically scanned his exemplary organized data structure and found the documents. Today, the said data structure is still exceptionally orderly, but only to reveal several very describing filenames with a dot-asc or dot-pgp extension. Any comments? >If a small business owner doesn't trust his employees, all is lost anyway. >(Employees can post stuff from home, can take diskettes out of the >building, etc., so what is gained by monitoring their mail?) I thought that this was so self-evident that I did not even thought usefull to explain. I was not talking about having employees giving copies of their personnal private key but of their corporate private key. The one they use to transact business over unsecured lines, not the one they use to send raunchy messages to their lover. >And if an employer is known to monitor employee mail, this actually >increases his liability for certain things. (If an employer does not, then >he has a better defense of claiming that some employee was acting on his >own, etc.) I never talked of monitoring e-mail, only of making sure the business retains access to employee-generated documents. I used to have a private key for the company at a previous work location. The first thing I did was to give my boss my passphrase for being afraid of what could happens if ever they needed a critical document during my absence. He did not even know how to use PGP, but I made sure that somebody did. This is why I said that a "secret" copy would be given to the boss. He could encrypt the employees keys, print it on a micro-dot and hide it under his gold tooth cap. And that way, there is always deniability since there is official company policy. Or better, all the boss has to do is to generate the employee's keys himself. He could forever deny having made a copy and nobody could prove that he did. Personnally, I would make sure that all keys to be used to transact business be generated by the boss, to be handed on a diskette in person. As far as trying to prevent malicious action, I agree that there is no way an employer can do that. Anybody really intent on screwing up things can. Ciao jfa -- Jean-Francois Avon, Pierrefonds(Montreal) QC Canada DePompadour, Societe d'Importation Ltee Finest of Limoges porcelain and crystal JFA Technologies, R&D consultants physicists and engineers, LabView programing. PGP encryption keys at: http://w3.citenet.net/users/jf_avon http://bs.mit.edu:8001/pks-toplev.html ID# C58ADD0D : 529645E8205A8A5E F87CC86FAEFEF891 ID# 5B51964D : 152ACCBCD4A481B0 254011193237822C

1 0

One-Way Functions
by semprini＠theschool.com 17 Dec '03

17 Dec '03

I've read tons about how DES, PGP, and all of those programs use a one-way function involves the difficulty of factoring out numbers. Are there other one-way functions? --Dylan

1 0

Re: A Math problem related to cryptography
by phelix＠vallnet.com 17 Dec '03

17 Dec '03

On 19 Oct 1997 18:36:26 -0500, Jeffery Walker <jeff(a)beol.net> wrote: > > I have been working on some math and C++ code to implement it. The >problem relates to a possible new means of factoring. However, I have run >into a problem which I cannot solve. Indeed it maybe impossible. The >problem is this: > > Find and equation using only multiplication, division, GCD, LCM and >powers (not addition or subtraction) in terms of a and b which is equal to >a+b for all Integers. If so desired it can be assumed that a and b are >relative primes with a>b. Note that equivalent problems include but aren't >limited to finding a similar equation for a+1. If other functions such as >logs are required they may be allowed but I would have to look into it. > > To encourage people to answer I am offering $20 for a solution and >$10 for a proof that it is impossible. I will judge all answers as to the >validity both in terms of actually being correct (or in the case of a proof >a valid argument) and in that they do not use functions such as addition or >subtraction which are not allowed. > (why do I get the feeling that I'm doing somebody's homework assignment) Claim: In the realm of Integers, There does not exist a formula using only multplication,division,GCD,LCM,and powers such that f(a,b)=a+b for all integers a,b Proof (by contradiction): I assume that a,b are primes > 2. Lets also define x,y,z,w,m,n and any integer >=0 and C,D,E as any integer > 0. Now let's look at the operations available to us: multiplication and powers: C=C*(a^0)*(b^0) CD=E(a^0)*(b^0) where E=CD a=1*(a^1)*(b^0) a^2=1(a^2)*(b^0) Cab^2=C*(a^1)*(b^2) well , all results can be expressed in the following form: C*(a^x)*(b*y) division: a !| b and b !| a (here !| means "does not divide") (From here on out, lets assume that a !| C,D,E and b !| C,D,E. it makes things simpler) Ca/a=C*(a^0)*(b*0) Ca/D=E*(a^1)*(b^0) assuming that E | C I won't go through all this. It should be obvious that for all allowed divisions, the result can be expressed as C*(a^x)*(b*y) GCD: gcd(a,b)=1 gcd(a,C)=1 gcd(Ca,Da)=max(a,gcd(C,D)) gcd(Ca,Db)=gcd(C,D) gcd(C(a^x),C(a^y))=C(a^(min(x,y))) gcd(C(a^x)*(b^y),D(a^z)*(b^w))=gcd(C,D)*(a^(min(x,y)))*(b^(min(z,w)))) =E(a^m)*(b^n) for E=gcd(C,D) m=min(x,z) and n=min(y,w) so, all results of GCD can be expressed in the form: C(a^x)(b^y) LCM: LCM(C,D)=CD/gcd(C,D) LCM(C(a^x)*(b^y),D(a^z)*(b^w)) =CD*(a^(x+z))*(b^(y+w))/gcd(C(a^x)*(b^y),D(a^z)*(b^w)) =( CD/gcd(C,D) * (a^(|x+z-min(xz)|)) * (b^(y+w-min(yw)) = E(a^m)*(b^n) where E=CD/gcd(C,D)=lcm(C,D), m=x+z-min(x,z) , n=y+w-min(y,w) so, all results of LCM can be expressed in the form: C(a^x)(b^y) Now, as you can probably tell by now, I don't remember a damn thing about groups, rings, and fields. If i did, I could have done all of the above in one paragraph. SO, what I'm trying to say is that all the numbers you can operate on here will be of the form C(a^x)(b^y). SO you really have to prove at least the following C(a^x)(b^y)=a+b for some C>0, x,y>=0 integers Now, you could probably say that C=a+b, x,y=0, but that's a cop out and is probably not allowed. Now, watch while I cop out and provide an easy counterexample: assume some formula exists such that f(a,b)=a+b with f only using *,/,gcd,lcm,^ operators let a=5, b=7 Since I know that ultimately anything I do with constants and the operators 8,/,gcd,lcm,^ will result in something in the form of C(a^x)(b^y), I won't even mess with the formula there must exist some C>0, x,y>=0 that makes: C(5^x)(7^y)=5+7=12 of x>=1 and y>=1 then C(5^x)(7^y)>12 for all C>0 if x=0 and y=0, C=12 (this works) if x=1,y=0 then 5C=12. there is no C which satisfies this. if x=0,y=1 then 7C=12. there is no C which satisfies this. so, the only solution is C=12, or more generally, C=a+b oops, that can't be the formula since we're not allowed to do that. QED. Well, that was pretty sloppy, so lets be more general about this: C(a^x)(b^y)=a+b Now, I'm sure that somewhere in the history of mathematics somebody has proven that for primes a and b where a,b>2 that a*b>a+b. So, for any x,y,C>0, C(a^x)(b^y)>a+b. C, of course, cannot be negative, or zero, so all were left with is x or y being zero. Let y=0. we have: C*a^x=a+b C*a^x - a = b a*(C*a^(x-1) - 1 ) = b a*E=b Now, a and b are primes and a!=b. From the fundamental theorem of algebra, every number can be represented by a series of primes such as: p1^a1 * p2^a2 * p3^a3 * ... In a*E=b, if we factor each side down to its primes, we find that the right hand side does not contain the prime 'a' which is on the left hand side, so a*E != b. A similar argument can be used for the case x=0. This leaves the only solution to C(a^x)(b^y)=a+b being x=0,y=0 C(a^0)(b^0)=C=a+b which isn't allowed. QED Now, If you're like me, you've probably read the above and don't have a f*cking clue what I meant (I sure wouldn't if I read all that crap). So here's the executive summary. With the operators you've defined on the number set you want to work with, no matter how complicated or crazy your formula is, I can express the result at C(a^x)(b^y). And hopefully, I've shown that C(a^x)(b^y) cannot equal a+b except in the trivial case of C=a+b (with x,y=0) which is what you don't want. >Thanks, >Jeff >P.S. I am very interested in joining the coderpunks list as I do program >and am interested in cryptography as related to programming. If someone >would be kind enough to recommend me I thank you. > I wasn't aware that you had to be invited to the coderpunks list. Just send a message to majordomo(a)toad.com with the following in the body: subscribe coderpunks -- Phelix, who really should have been able to give a better proof (especially since one of my degrees has the word 'Mathematics' on it)

1 0

Fwd: list of keyservers
by Bill Stewart 17 Dec '03

17 Dec '03

Attila sent the following list of keyservers ---------------------------------------------------------- the following is a collection of key servers; and there are more. <a href="http://pgp5.ai.mit.edu/pks-commands.html"> bal keyserver at MT </a> <a href="http://www.pgp.com/keyserver/pks-lookup.cgi"> pgp corporate keyserver </a> <a href="http://akpublic.research.att.com:80/~reiter/PathServer/"> reiter PathServer at research.att </a> <a href="http://w3.gti.net/netrin/matrix/"> Matrix Key Server </a> (an oddball, down on 19/10/97) the rest are clones of MIT <a href="http://goliat.upc.es/~alvar/pks/pks-toplev.html"> Universitat PolitÞcnica de Catalunya, Barcelona </a> <a href="http://www.cl.cam.ac.uk/PGP/#pks"> Cambridge University </a> <a href="http://www.service.uit.no/pgp/servruit.eng.html"> University of Troms </a> <a href="http://www.nic.surfnet.nl/pgp/pks-toplev.html"> Tilburg University </a> <a href="http://math-www.uni-paderborn.de/pgp/"> University of Paderborn </a> <a href="http://pgp.tnjc.edu.tw/pgp/pks-toplev.html"> Tung-Nan Junior college, Taiwan </a> <a href="http://pgp.uni-mainz.de/keyserver"> University of Mainz </a> Thanks! Bill Bill Stewart, stewarts(a)ix.netcom.com Regular Key PGP Fingerprint D454 E202 CBC8 40BF 3C85 B884 0ABE 4639

1 0

InfoWar Epilogue 5 / TEXT
by TruthMonger 17 Dec '03

17 Dec '03

---------------------------------------------------------------------------- ---------------------------------------------------------------------------- The True Story of the InterNet Part III InfoWar Final Frontier of the Digital Revolution Behind the ElectroMagnetic Curtain by TruthMonger <tm(a)dev.null> Copyright 1997 Pearl Publishing ---------------------------------------------------------------------------- ---------------------------------------------------------------------------- InfoWar Table of Contents * Epilogue * Cowboy ---------------------------------------------------------------------------- Epilogue ---------------------------------------------------------------------------- 11 May 1905 Walking on the Marktgasse, one sees a wondrous sight. The cherries in the fruit stalls sit aligned in rows, the hats in the millinery shop are neatly stacked, the flowers on the balconies are arranged in perfect symmetries, no crumbs lie on the bakery floor, no milk is spilled on the cobblestones of the buttery. No thing is out of place. When a gay party leaves a restaurant, the tables are more tidy than before. When a wind blows gently through the street, the street is swept clean, the dirt and dust transported to the edge of town. When waves of water splash against the shore, the shore rebuilds itself. When leaves fall from the trees, the leaves line up like birds in V-formation. When clouds form faces, the faces stay. When a pipe lets smoke into a room, the soot drifts toward a corner of the room, leaving clear air. Painted balconies exposed to wind and rain become brighter in time. The sound of thunder makes a broken vase reform itself, makes the fractured shards leap up to the precise positions where they fit and bind. The fragrant odor of a passing cinnamon cart intensifies, not dissipates, with time. Do these happenings seem strange? In this world, the passage of time brings increasing order. Order is the law of nature, the universal trend, the cosmic direction. If time is an arrow, that arrow points toward order. The future is pattern, organization, union, intensification; the past, randomness, confusion, disintegration, dissipation. Philosophers have argued that without a trend toward order, time would lack meaning. The future would be indistinguishable from the past. Sequences of events would be just so many random scenes from a thousand novels. History would be indistinct, like the mist slowly gathered by treetops in the evening. In such a world, people with untidy houses lie in their beds and wait for the forces of nature to jostle the dust from their windowsills and straighten the shoes in their closets. People with untidy affairs may picnic while their calendars become organized, their appointments arranged, their accounts balanced. Lipsticks and brushes and letters may be tossed into purses with the satisfaction that they will sort themselves out automatically. Gardens need never be pruned, weeds never uprooted. Desks become neat by the end of the day. Clothes on the floor in the evening lie on chairs in the morning. Missing socks reappear. If one visits a city in the spring, one sees another wondrous sight. For in springtime the populace becomes sick of the order in their lives. In spring, people furiously lay waste to their houses. They sweep in dirt, smash chairs, break windows. On Aarbergergasse, or any residential avenue in sprint, one hears the sounds of broken glass, shouting, howling, laughter. In spring, people meet at unarranged times, burn their appointment books, throw away their watches, drink through the night. This hysterical abandon continues until summer, when people regain their senses and return to order. {Excerpt from "Einstein's Dreams" by Alan Lightman} ---------------------------------------------------------------------------- ---------------------------------------------------------------------------- Cowboy "All My Lies Are True, And everything I do, I really Am." - Carroll In other words, if it looks like a duck, walks like a duck and quacks like a duckit's probably a duck. Reality is a Freudian slip. InfoWar has been around since Adam and Eve gobbled down on the fruit from the Tree of the Knowledge of Good and Evil. The fig leaf was the first cover-up. "Sorry, God, but what's under there is Top Secret." Adam blamed Eve, Eve blamed the Serpent, and the Serpent blamed his publicity department, fired six people, replaced them with Spin Doctors, and went on to become President. Figuratively speaking, of course. Now all of the CypherPunks are sitting around slapping their foreheads and saying: Old Farts: "I should have listened to Lenny Bruce." Middle Aged Farts: "I should have listened to Bob Dylan." Young Farts: "I should have listened to Marilyn Manson." Stupid Farts: "I should have listened to TruthMonger." People you should have lynched, and now it's too late: The person who named a nuclear missile, 'The PeaceKeeper.' The President who let slip the words, 'New World Order.' The first person to utter, "What the President meant to say, was" Everyone who said, "I'm from the government, and I'm here to help you." ad infinitum How many Nazi intelligence agents and rocket scientist were brought into the US after World War II to work with the government and large corporations? Sorry, Top Secret. How much biological and germ warfare research is being done with your tax money? Sorry, Top Secret. How many foreign leaders, politicians, diplomats and business men have been assassinated using your tax dollars? Sorry, Top Secret. Of course, now 'National Security' is the 'magic word.' (Or is that 'magic sword?') "Intelligence reports indicate that terrorists breathe" {Go ahead and extrapolate the preceding government statement to its final conclusion. Don't forget the breathing tax that will be necessary to cover the costs of the digital nose implants.} Your education wasn't 'free,' was it? You had to pay for it by Pledging Allegiance every morning. You had to pay for it by sitting up straight at your desk. You had to pay for it by asking permission to pee. You had to pay for it by making sure your desk was lined up straight with the others. You had to pay for it by shutting the fuck up when you had a creative thought, and hypnotically repeating back the lessons you were taught. Who discovered America? And what the fuck were all of those goddamn Indians doing there when it was 'discovered?' Fucking troublemakers Interactive. Doesn't that sound better than Corporate Message Recovery? Better than Government Access to God-and-Everything? The cynics make it all sound so dark and damning. All the Fascists really want is to make certain that everyone is sitting up straight in their seatsthat the seats are lined up properlythat no one forgets to pledge allegiancethat you ask permission before you pee "THERE IS NO SECRET PLOT AGAINST THE CYPHERPUNKS LIST!!!" We are here to help you Tim, sit up straight in your chair. Lucky, sit down, you can go to the bathroom when I'm finished talking. Bill, Bill and William, no more back-talk. Adam, apologize to PGP. Duncan, quit fidgeting. Peter, have you been passing notes to TruthMonger, again? Blanc, Mr. Gates will not be allowed to pick you up after class unless he brings a note from your parents. Matthew and Phil, from now on we will be using 3.0 as the value of pi, as per the new legislation. Toto! Pull up your pants and leave that puppy alone. Thank you for the apple, Kent. Would you like to lead the class in pledging allegiance to PGP for Corporations? When a US Armed Forces trained killer attacked a Federal Government Building, who got the blame? Citizens. Citizens with guns. Citizens with non-government guns. The Paramilitary. When a US Secret Intelligence Agency trained cryptographer attacks a Federal Government Computer System, who will get the blame? Citizens. Citizens with crypto-munitions. Citizens with non-government crypto-munitions. The CypherPunks. Have you figured out what 'InfoWar' is, yet? Cryptography is merely a battleground. Encryption is merely one of the most dangerous weapons against the goals of InfoWar. The War is over who will control Information. The War is over who will control Words. The War is over who will control Thoughts. The War is over who will control Attention. The War is over who will control Virtual Reality. The War is over who will control WebWorld. World War III is InfoWar! Whoever controls Information, controls the Past. Oswald acted alone.. Whoever controls Information, controls the Present. Gilmore acted alone. Whoever controls Information, controls the Future. Tim C. May acted alone Repeat after me: "Department of Defense secret agencies created the InterNet, but they do not control and/or monitor all activity and communications that take place on it." "The government has shifted the focus of their engineers, physicists and secret intelligence agencies from nuclear warfare to information warfare, but they would not manipulate, destroy and murder those who present a threat to their preeminence in this arena of warfare." "When the government's secret underground laboratories reveal and share the technology of radar that can see through solid walls, satellite cameras that can read the newspaper over your shoulder, and tiny helicopters that can fit inside a peanut shell, they are not in possession of even greater forms of clandestine technology." Reality Check: Why is strong encryption such a dangerous threat to the secret and semi-secret agencies, committees and non-government bodies who rule us from the shadows? It is because they already have the ability to monitor all of our activities and communications. Widespread use of strong encryption threatens that ability. People who control technology and standards are on the inside. People who make the chips that go into the computers and peripherals are on the inside. People who supply the physical routes that information travels over are on the inside. People who use the above, are on the outside. Arms for drugs, drugs for money-arms, drugs and money for favors and information. Our secret intelligence agencies tell our legislators that use of strong crypto will interfere with their manipulation of the electronic funds of the 'bad' individuals, corporations, and governments. Why did Colonel Olive North trade weapons and drugs to have the hostages held until Ronnie RayGuns election and then released on the day of his inauguration? Because weapons were what the Iranians wanted. What if the Iranians had wanted Sun Microsystems financially ruined in return for the timed release of the hostages? Or Intel? Or Tim C. May? (Who knows? Maybe the Tim C. Mayonnaise ASCII Art is part of the Iran-Contra deal.) Did the US Secret Intelligence Agencies support the development and release of cryptography that they couldn't break, or didn't have a backdoor to? If so, then why was PGP such a threat to 'National Security?' If the Men in Black don't already have ready access to information hidden within current forms of encryption, then why would widespread use of strong encryption be a threat? Try this: Go to a command line: type 'cd \PGP262' ; type 'pgp -kxa "My KeyID" secring.pgp' Send the output file to Louis J. Freeh, and ask him to please not read your encrypted files. Now: Do the same thing, only dialing in to your machine from a friend's machine. Now: Write a browser Java script that gets the secring.pgp file from your machine via a web site. Now: Go home, kick your fucking door in, place a disk in the floppy drive, and type 'pgp -kxa "My KeyID" a:\secring.asc secring.pgp'. Mail the disk to Louis J. Freeh Does your copy of PGP ask for a password before spitting out the KeyID to any one of a thousand monkeys who sits at your keyboard and randomly types in the above? My copy doesn't. Below is a copy of a key pulled off of my computer by 19 different people. It was pulled off of my hard drive by the first individual, who proceeded to inform a second individual of the method used, and challenged them to do the same thing, using a different method. The second did so, and passed all the information along to a third person, etc., etc. Nineteen people, nineteen different methods. -----BEGIN PGP MESSAGE----- Version: 2.6.2 lQHgAzHiUJEAAAEEAP1slPSwrVd90NVBqfsw6+JP64icmuSrztzyCgaPcXHRiy/J Kbgi9/gy1iCnWcQh1ATaSzblATSU24Xw+4Ow4s5xOvdxFGoIop6EXwTNfwRa2EZr 6ZZ41Glr9g1g9H0RJwJlkldUcunVNekXel1MYA8VJJynvtZVuntA11SbF0AdAAUT Ab7sJWrM/6azA/vV2wq4sdyfngUgUHq8Hlo5NHvEjyh2cSoMMNxnpKR3+XYRbYTd HhwfbOvji1cWnVJF6GBxe3nLvbkbHJU+K3hNNYOT9JKMahu+5wKMbHkwToSsLzyQ kgn2JlKDJugoycdjInlQs7NiyoOrIYWQzSi4yGbhl2t1Au+67UY/r57J9AIA8V/6 J5x1wH7MACSWU91jXXxpJvSud053nrSgnupEUbFX3dXm0GXf6vdhbQW9eYsIJmCI pZLrqwBcFe2GWhk9AAIActyoxAgCvFyGSJHHzJVVoKfWk/gjmKs/r7+J9vWnBAkc Pg0wqUn66Hmq0op28gEXU3qKJiJ8rAQETAxBhfpnJgH83CrrEZDcBY8IKsFI2A19 KahohyDXmsEHIWqKZLSwzjsYcf049RCUxNDPJZchuoMEPkK9414KyPqlJbStsFaE YZ6itAxNYWdpYyBDaXJjbGU= =GEo6 -----END PGP MESSAGE----- Are your 'secret' keys any more secure than mine? Answer: If you send me a message encrypted to the key above, then it doesn't really matter, does it? The end result is the same. Strong crypto is not a threat. Widespread use of strong crypto is a threat. The Monitors cannot put the latest-greatest spy chip in every computer, every printer, every modem. They cannot password-snarf every system. They cannot compromise every remailer, every ISP, every private network. At present, they don't need to. They can enter my house, and your house, and grab our keys. They can't do so for everyone, but they don't need to, because everyone isn't using strong crypto. They can monitor your keyboard and mine, but they can't monitor everybody's. They can beat you and I with rubber hoses, but they can't beat everyone with rubber hoses (although they can dream). The days of Judicial Safeguards are history. There is no longer any need to go down to the local Teleco and flash a warrant to get access to telephone conversations. The Monitors own the satellites. Warrants are for when they are ready to go to trial, and they want to do it by the book. Hackers don't get warrants. Hackers don't need no stinking badgesand neither do secret intelligence agencies. What is the problem with widespread use of strong crypto? It gets in the way of immediate access to data and communications. If you understand nothing else about InfoWar, understand this: The Monitors already have access to almost all data and communications. They are not attempting to get something they don't have, they are trying to hold onto something that they already have. They can't kill a news story or editorial after it comes out. They can't put genies back in the bottle after they are released. Arranging for you to have an unfortunate accident tomorrow doesn't erase the email you sent today. Try this: Get email accounts in the names of your children. Send messages back and forth between them. Analyze the send and receive timing of the Dr. Seus messages, as opposed to those of the 'Death Threat' and 'Tim McVeigh' messages. Do traceroutes to find out how the accounts travel via routes to a variety of systems. Then send emails between the accounts which threaten the lives of world leaders and various politicians. Now do traceroutes and find out what routes the accounts travel. And remember, this is for your children's accounts. The Monitors can get access to the keys of a thousand individuals at a corporation, but this is unacceptable. They want access to one key that allows them to access all of the thousand individual's files and communications. Their goals are quite simply to control and monitor information as close to the source as possible. This is why they need 'Official' news sources. 'Approved' websites. 'Authorized' encryption programs. This is why they give away billions of dollars of digital airwaves to mainstream media. This is why they launch, and then settle, anti-trust actions, lawsuits, financial and criminal investigations. NEWS FLASH!!! Louis J. Freeh just discovered that he can ensure the institution of GAK, CMR, and all manner of CRAP by killing your newborn child. Aren't you glad he's one of the 'good' guys? Follow the Money! Why do the Monitors want guaranteed access to all information by 1999? Why are the Europeans planning to introduce a new form of currency in 1999? What plans do the IRS have for 1999, when it becomes obvious that many individuals, companies, and countries do not have the capability to keep their bookwork from falling into chaos? Nothing? Right The US has plans in place for invading Canada in the event that there is a need to do so, but they have no plans in place for financial and organizational chaos being created by the Year2000 Bug. Right Governments, corporations, the rich and powerfulnone of them have any plans in place to take advantage of any problems that arise in society, in government, in financial empires, due to the Y2K Bug. Right The 'solutions' are already planned, and in place, waiting for the problem. The solutions are pre-GAK'ed. The solutions have eyes and ears. Why is the IRS being 'rehabilitated' by Congressional investigation? In preparation for 1999. Just as the FBI, the CIA, the DOJ, etc., have been 'rehabilitated.' Just as the government has been 'rehabilitated' by the Freedom of Information Act, etc., while more and more power is put into the hands of unelected committees, commissions and semi-secret agencies. InfoWar is being fought on the battlegrounds of Virtual Reality, which are linked by the Information Highway. The armies are governmental and corporate. The victor's prize, as always, is wealth and power. On the battlefield of Encryption the war is over Access. On the battlefield of Virtual Private Networks, the battle is for Access. The warplanes, ships, tanks, rockets and missilesthe air, sea and ground warsthese are a dog-and-pony show for the masses. Just as the 'news' is for the masses. When the Canadian Prime Minister is caught on audio-video calling the US government criminals and thieves, this is news. This is why he doesn't say those things into the microphone, except by accident. It is not 'official' news, not 'managed' news, and it will not be expanded upon for the general public. The 'Official' news is 'Blah, blah, blah' Even the 'Official' news isn't really 'official' when the governments deny it. The Israelis didn't really release a political prisoner as a result of a deal to have their assassination team returned. Canadian intelligence agencies don't really help the Mossad obtain false Canadian passports in return for having their own back scratched. As long as they pretend they didn't really get caught, then they can keep pretending that they don't do this type of thing all of the time. This is InfoWar There are good pictures and bad picturesgood words and bad wordsgood thoughts, ideas and beliefs, and bad ones. The good people are here, where I am standing, and the bad people are over there, where I am pointing. My information is good information. Anything else is bad information. There are good URL's and bad URL's, good communications and bad communications. The Constitution needs to be explained to your children by those who wrap themselves in the flag, not by those who burn the flag. CyberSitter! The Bill of Rights needs to be explained to your children by those who imprison and kill marihuana smokers, not by those who smoke marihuana, even if they are doing so in a place where it is legal. CyberSitter! The Truth needs to be told to your children by those who the government gives billions of dollars worth of the citizens' digital airwaves, not by an armed forces veteran who is telling his story on his own web page as the life force drains from his body due to his imagined Gulf War Syndrome. CyberSitter! Dimitri Vulis needs to be forcefully unsubscribed from the CypherPunks Mailing List. SandySitter! "You want anarchy? You can't HANDLE anarchy!" - Jack Nicholson, playing Terry Nichols, in "Nuke the Murrah Federal Building!" InfoWar There will be soldiers, spies, collaborators and members of the resistance. There will not be any winners, only survivors. There will be survivors who can hold their heads high, and those who cannot. Never forget ---------------------------------------------------------------------------- "The Xenix Chainsaw Massacre" "WebWorld & the Mythical Circle of Eunuchs" "InfoWar (Part III of 'The True Story of the InterNet') Soviet Union Sickle of Eunuchs Secret WebSite ----------------------------------------------------------------------------

1 0

InfoWar Epilogue 5 (Part III of 'The True Story of the InterNet')
by TruthMonger 17 Dec '03

17 Dec '03

1 0

List of reliable remailers
by Raph Levien 17 Dec '03

17 Dec '03

I operate a remailer pinging service which collects detailed information about remailer features and reliability. To use it, just finger remailer-list(a)kiwi.cs.berkeley.edu There is also a Web version of the same information, plus lots of interesting links to remailer-related resources, at: http://www.cs.berkeley.edu/~raph/remailer-list.html This information is used by premail, a remailer chaining and PGP encrypting client for outgoing mail. For more information, see: http://www.c2.org/~raph/premail.html For the PGP public keys of the remailers, finger pgpkeys(a)kiwi.cs.berkeley.edu This is the current info: REMAILER LIST This is an automatically generated listing of remailers. The first part of the listing shows the remailers along with configuration options and special features for each of the remailers. The second part shows the 12-day history, and average latency and uptime for each remailer. You can also get this list by fingering remailer-list(a)kiwi.cs.berkeley.edu. $remailer{'cyber'} = '<alias(a)alias.cyberpass.net> alpha pgp'; $remailer{"mix"} = "<mixmaster(a)remail.obscura.com> cpunk mix pgp hash latent cut ek ksub reord ?"; $remailer{"replay"} = "<remailer(a)replay.com> cpunk mix pgp hash latent cut post ek"; $remailer{"jam"} = "<remailer(a)cypherpunks.ca> cpunk mix pgp hash middle latent cut ek"; $remailer{"winsock"} = "<winsock(a)rigel.cyberpass.net> cpunk pgp pgponly hash cut ksub reord ?"; $remailer{'nym'} = '<config(a)nym.alias.net> newnym pgp'; $remailer{"squirrel"} = "<mix(a)squirrel.owl.de> cpunk mix pgp pgponly hash latent cut ek"; $remailer{'weasel'} = '<config(a)weasel.owl.de> newnym pgp'; $remailer{"reno"} = "<middleman(a)cyberpass.net> cpunk mix pgp hash middle latent cut ek reord ?"; $remailer{"cracker"} = "<remailer(a)anon.efga.org> cpunk mix remix pgp hash ksub esub latent cut ek reord post"; $remailer{'redneck'} = '<config(a)anon.efga.org> newnym pgp'; $remailer{"bureau42"} = "<remailer(a)bureau42.ml.org> cpunk mix pgp ksub hash latent cut ek"; $remailer{"neva"} = "<remailer(a)neva.org> cpunk pgp pgponly hash cut ksub ?"; $remailer{"lcs"} = "<mix(a)anon.lcs.mit.edu> mix"; $remailer{"medusa"} = "<medusa(a)weasel.owl.de> mix middle" $remailer{"McCain"} = "<mccain(a)notatla.demon.co.uk> mix middle"; $remailer{"valdeez"} = "<valdeez(a)juno.com> cpunk pgp pgponly hash ek"; $remailer{"arrid"} = "<arrid(a)juno.com> cpunk pgp pgponly hash ek"; $remailer{"hera"} = "<goddesshera(a)juno.com> cpunk pgp pgponly hash ek"; $remailer{"htuttle"} = "<h_tuttle(a)rigel.cyberpass.net> cpunk pgp hash latent cut post ek"; catalyst(a)netcom.com is _not_ a remailer. lmccarth(a)ducie.cs.umass.edu is _not_ a remailer. usura(a)replay.com is _not_ a remailer. remailer(a)crynwr.com is _not_ a remailer. There is no remailer at relay.com. Groups of remailers sharing a machine or operator: (cyber mix reno winsock) (weasel squirrel medusa) (cracker redneck) (nym lcs) (valdeez arrid hera) The remailer list here has been out of date for some time, but should be up to date now. I'm still working on updating the web page. Last update: Mon 20 Oct 97 6:49:47 PDT remailer email address history latency uptime ----------------------------------------------------------------------- hera goddesshera(a)juno.com ------------ 5:43:20 99.87% nym config(a)nym.alias.net ## +*#**#**# :54 98.85% redneck config(a)anon.efga.org ** #*##*+#** 2:01 98.73% neva remailer(a)neva.org - ------*** 1:18:50 98.70% squirrel mix(a)squirrel.owl.de ----- ---+- 2:40:29 98.48% mix mixmaster(a)remail.obscura.com +* +++ ++++* 22:14 98.34% winsock winsock(a)rigel.cyberpass.net -- -..-..-- 12:20:42 97.94% cyber alias(a)alias.cyberpass.net ** *++***+ * 10:04 97.76% replay remailer(a)replay.com ** **** ** 4:08 97.45% bureau42 remailer(a)bureau42.ml.org -- ------- 3:34:49 96.52% arrid arrid(a)juno.com -- ----.--- 8:34:46 96.27% cracker remailer(a)anon.efga.org + + +*+*+* 15:01 94.84% jam remailer(a)cypherpunks.ca + + +*-+++ 22:50 94.53% valdeez valdeez(a)juno.com 4:58:22 -33.42% reno middleman(a)cyberpass.net + 1:01:28 9.14% History key * # response in less than 5 minutes. * * response in less than 1 hour. * + response in less than 4 hours. * - response in less than 24 hours. * . response in more than 1 day. * _ response came back too late (more than 2 days). cpunk A major class of remailers. Supports Request-Remailing-To: field. eric A variant of the cpunk style. Uses Anon-Send-To: instead. penet The third class of remailers (at least for right now). Uses X-Anon-To: in the header. pgp Remailer supports encryption with PGP. A period after the keyword means that the short name, rather than the full email address, should be used as the encryption key ID. hash Supports ## pasting, so anything can be put into the headers of outgoing messages. ksub Remailer always kills subject header, even in non-pgp mode. nsub Remailer always preserves subject header, even in pgp mode. latent Supports Matt Ghio's Latent-Time: option. cut Supports Matt Ghio's Cutmarks: option. post Post to Usenet using Post-To: or Anon-Post-To: header. ek Encrypt responses in reply blocks using Encrypt-Key: header. special Accepts only pgp encrypted messages. mix Can accept messages in Mixmaster format. reord Attempts to foil traffic analysis by reordering messages. Note: I'm relying on the word of the remailer operator here, and haven't verified the reord info myself. mon Remailer has been known to monitor contents of private email. filter Remailer has been known to filter messages based on content. If not listed in conjunction with mon, then only messages destined for public forums are subject to filtering. Raph Levien

1 0

Re: [LONG, off-topic]] Interactive Programming (fwd)
by Brandon Crosby 17 Dec '03

17 Dec '03

> > LISP programmers are much more into writing programs which > > build and execute routines on the fly. > > As are some perl programmers. As both a perl programmer and a lisp > programer I have never had the need to use self modifing code. In fact I > would consider haveing to use s-m code as a sine that I have made a > mistate in my desinge. > PERL is a pretty high-level language... how do you add sub's after running the code? -Brandon Crosby

3 2

RE: One-Way Functions
by Ian Clysdale 17 Dec '03

17 Dec '03

Yes, there are a number of other one-way functions. The Diffie-Hellman algorithm relies on the difficulty in taking logarithms versus finding an exponent. Elliptic-curve cryptography relies on some rather complicated group theory. Look either of those up to find out some more information. If you're interested in learning about this kind of stuff, I HIGHLY recommend Bruce Schneier's Applied Cryptography. Another good book is the Handbook of Applied Cryptography by Paul Van Oorschot, Alfred Menenzes and Scott Vanstone. ian >---------- >From: semprini@theschool.com[SMTP:semprini@theschool.com] >Sent: Monday, October 20, 1997 4:04 AM >To: cypherpunks(a)toad.com >Subject: One-Way Functions > >I've read tons about how DES, PGP, and all of those programs use a >one-way function involves the difficulty of factoring out numbers. >Are there other one-way functions? > >--Dylan >

1 0

How Fast Is your System?
by Robert Hettinga 17 Dec '03

17 Dec '03

--- begin forwarded text X-Sender: fm(a)mail.espace.net Mime-Version: 1.0 Date: Mon, 20 Oct 1997 10:52:46 +0100 To: usual(a)espace.net From: Fearghas McKay <fm(a)espace.net> Subject: How Fast Is your System? Sender: <usual(a)espace.net> Precedence: Bulk List-Software: LetterRip 2.0.1 by Fog City Software, Inc. List-Subscribe: <mailto:requests@espace.net?subject=subscribe%20usual> List-Unsubscribe: <mailto:requests@espace.net?subject=unsubscribe%20usual> Status: U --- begin forwarded text How Fast Is your System? Project RC5 is an attempt to beat the RSA Secret-Key Challenge by using desktop computers to plug away at possible solutions in their spare processor time. One nifty side effect of all these boxes attempting the same process is an accurate comparison of true processor speeds. The compiled statistics show clearly what is often overlooked: not all megahertzes are created equal. A 180-MHz Pentium Pro ranges from 413 kk/s (thousand keys per second) running Windows 95 to 461 kk/s under Linux. In comparison, 180-MHz Macs range from 434 kk/s (a Motorola machine with a 603e chip running MacOS 7.6.1) to 530 kk/s (a Motorola 604e with MacOS 8). That's a significant difference. The fastest single-processor computer is a Power Mac 9600/350, with a 350-Mhz PowerPC 604e chip, that slices through 1012 kk/s. Check these stats out and compare not only platforms, but operating systems, too. [Netsurfer=92s Digest] RC5: <http://www.distributed.net/rc5/>=20 RSA: <http://www.rsa.com/rsalabs/97challenge/>=20 Stats: <http://www.alde.com/speed.html> --- end forwarded text --- end forwarded text ----------------- Robert Hettinga (rah(a)shipwright.com) Philodox e$, 44 Farquhar Street, Boston, MA 02131 USA "... however it may deserve respect for its usefulness and antiquity, [predicting the end of the world] has not been found agreeable to experience." -- Edward Gibbon, 'Decline and Fall of the Roman Empire' The e$ Home Page: http://www.shipwright.com/ Ask me about FC98 in Anguilla!: <http://www.fc98.ai/>

1 0

A Beehive in their Bonnet, from The Netly News
by Declan McCullagh 17 Dec '03

17 Dec '03

*********** http://cgi.pathfinder.com/netly/opinion/0,1042,1509,00.html The Netly News (http://netlynews.com/) October 20, 1997 A Beehive in Their Bonnet by Declan McCullagh (declan(a)well.com) John Caldeira's remark in a beekeeper's discussion area on Prodigy seemed innocuous enough: It described how to rid honeybees of parasites. "Two ounces of Mavrik mixed with one gallon of water and sprayed on the bottom boards of one's hives several times a year. It is reportedly very effective," Caldeira wrote. Honey may attract flies, but this discussion about its production drew swarms of bureaucrats. The Texas Department of Agriculture charged Caldeira with violating a state law banning unapproved discussions of bee medicines and fined the 42-year-old hobbyist $600. A draft statement from the department complains that Caldeira was "criticizing regulations" and improbably argues that "the honey market in the U.S. could become depressed because of widespread concerns about its safety and due to Mr. Caldeira's suggestion that commercial beekeepers are using Mavrik in their hives." But the Texas bureaucrats have a problem: The law seems to violate the First Amendment's guarantees of freedom of speech. "There is absolutely no doubt that John Caldeira's speech is -- and should be -- protected speech under the First Amendment to the U.S. Constitution," says Mike Godwin, staff counsel to the Electronic Frontier Foundation. [...]

1 0

index.html
by Jim Choate 17 Dec '03

17 Dec '03

CNN logo Navigation Infoseek/Big Yellow Pathfinder/Warner Bros Tech banner IBM Reinventing Education rule JUSTICE SEEKS $1 MILLION A DAY CONTEMPT FINE AGAINST MICROSOFT Microsoft logo October 20, 1997 Web posted at: 1:29 p.m. EDT (1729 GMT) WASHINGTON (AP) -- The Justice Department asked a federal court Monday to hold the computer software giant Microsoft Corp. in contempt for requiring personal computer manufacturers to license and distribute its Internet browser. The department said the company violated a 1995 court order the government obtained to bar the company from anticompetitive licensing practices. The government sought a $1 million a day fine. "Microsoft is unlawfully taking advantage of its Windows monopoly to protect and extend that monopoly," Attorney General Janet Reno told reporters. Janet Reno "This is a very serious abuse," said Assistant Attorney General Joel I. Klein, head of the antitrust division. He said Microsoft's action was designed to undermine the dominant market position of its major competitor for Internet browsers, Netscape. Internet browsers are important, Klein said, because they "could erode Microsoft's operating system monopoly" in the Windows operating system. "This kind of product forcing is an abuse of monopoly power and we seek to put an end to it." Klein emphasized that the Justice Department is still investigating other practices by Microsoft but declined to give details. The Justice Department objected to Microsoft's requirement that computer manufacturers who want to license the Windows 95 operating system also license its internet browser, known as Internet Explorer. Most personal computer makers install Windows 95 at the factory. Klein said, "These are two different products." He said they should be sold as two separate products, but he adamantly said the government was not taking sides in the war for browser market share between Microsoft and Netscape, whose browser is known as Navigator, or any other company. "Each of Microsoft's products should compete on its own merits," Klein said. Copyright 1997 The Associated Press. All rights reserved. This material may not be published, broadcast, rewritten, or redistributed. _________________________________________________________________ Infoseek search ____________________ ____ ____ _________________________________________________________________ rule Watch these shows on CNN for more sci-tech stories: CNN Computer Connection | Future Watch | Science & Technology Week rule Message Boards Sound off on our message boards You said it... [INLINE] IBM Reinventing Education rule To the top © 1997 Cable News Network, Inc. All Rights Reserved. Terms under which this service is provided to you.

1 0

Re: Save Water... ask me how!
by nobody＠REPLAY.COM 17 Dec '03

17 Dec '03

martian(a)rt66.com wrote: > Ask me how to save water. > http://www.rt66.com/martian Did anyone else go there? What a smell, eh? Whoooeee. I bet that guy saves a *lot* of water. Human-Gus Peter

1 0

SMTP Encryption Extension
by mskala＠langara.csc.UVic.CA 17 Dec '03

17 Dec '03

Lots of people want to encrypt network traffic in large quantities to deter wiretapping, raise awareness, and so on. The usual approach seems to be to encrypt at a very low level, on individual network links. Unfortunately, those plans aren't moving very fast, partly because they require the involvement of people in positions of power at both ends of any given link. If I'm the sysadmin of a major ISP, I've got more important things to worry about than trying to coordinate with my counterpart at the other end of a high-speed link that is ALREADY WORKING FINE, and trying to change the protocol. Well, what are we really concerned about? Not Web traffic - although your web surfing history is private information, the data itself is by nature public and encrypting it is kinda pointless. The same kind of argument applies to news. What we're really concerned about w.r.t. wiretapping is electronic mail. So why not extend SMTP to do strong encryption? When your SMTP mailer connects to another mailer with the encryption extension, they exchange public keys, use those to exchange a session key, and encrypt their traffic. When your smart mailer connects to a stupid mailer, they just speak normal SMTP. This is a win even without any special key management: even if I can't verify that the identity of the remote SMTP server is correct, I'm still protected from passive attacks if I know that only the remote server (whoever that is) can read the traffic. If we're concerned about government surveillance of the populace, passive wiretaps are by far the most significant threat. This has the advantage that it only requires support from the admins of the computers that send and receive email; your ISP doesn't have to cooperate. Also, it doesn't require cooperation between the two ends of a connection: I can put the crypto extension onto my system without worrying about whether any other specific person will cooperate. Finally, it's got good subversive potential; the benefits of having the extension increase exponentially as more people have it. Just imagine if we could get a major Linux distribution to install it by default. Wham! All of a sudden, whenever any two boxes running that distribution connect to each other, they automatically do it securely. The ideal way to implement this would be as a patch to sendmail, but for short term "proof of concept", I'm building a Perl program that will listen on port 25, accept SMTP connections, and pass the data through to a copy of sendmail running on some other port. It also has a client side which gets installed as a "mailer" under sendmail, replacing sendmail's built-in IPC mailer. When two copies of sendmail so equipped connect to each other, they automatically encrypt. I've already got code for a program I call "blackpony", that implements the basic protocol using RSA and Blowfish (extensible to others). It also supports ROTn, in order to provide a cryptosystem people can do in their heads while manually testing the program. I haven't finished testing the integration between it and sendmail, and I'd like to document the protocol more thoroughly, but it does work, and it transparently interoperates with ordinary sendmail. I expect to have it in a form I'll be willing to show people, within the week. If anyone would like a copy or has any comments or suggestions, please let me know. Perl5 is required, as is the Cryptix security library available at http://www.systemics.com/software/. At present the Linux /dev/urandom device (or something like it) is required, but I intend to make that optional eventually. Deploy and enjoy...

1 0

Cato Institute briefing paper on domain names
by Declan McCullagh 17 Dec '03

17 Dec '03

*************** http://www.cato.org/pubs/briefs/bp-033.html INTERNET DOMAIN NAMES Privatization, Competition, and Freedom of Expression by Milton L. Mueller Milton L. Mueller, an associate professor at the Syracuse University School of Information Studies, is the author of many scholarly works on telecommunications policy. Executive Summary There is growing confusion over the administration of Internet top-level domain names (TLDs), the system of suffixes, such as .com, .org, and .edu, that determines a person's e-mail or Web site address on the Internet. We need to define rules and procedures that will permit and encourage competition among administrators of TLDs in response to market demand. Freedom of expression should be a primary concern. Proposals for compulsory national TLDs should be rejected. National TLDs would undermine the international character of the Internet and encourage national governments to enact myriad petty regulations and restrictions on free speech. Domain names should not be equated with trademarks or brand names. We should reject attempts to forge inappropriate links between domain name registration and trademark protection. The U.S. government should encourage the development of property rights and competition by moving the administration of Internet domain names into the private sector. ### ------------------------- Declan McCullagh Time Inc. The Netly News Network Washington Correspondent http://netlynews.com/

1 0

DNA encrypted messages (fwd)
by Jim Choate 17 Dec '03

17 Dec '03

Forwarded message: >From owner-traveller(a)Phaser.ShowCase.MPGN.COM Mon Oct 20 18:05:46 1997 Message-Id: <199710202034.WAA19474(a)vip.cybercity.dk> From: "Mark Seemann" <dko3835(a)vip.cybercity.dk> To: <traveller(a)MPGN.COM> Subject: DNA encrypted messages Date: Mon, 20 Oct 1997 22:28:39 +0200 X-MSMail-Priority: Normal X-Priority: 3 X-Mailer: Microsoft Internet Mail 4.70.1155 MIME-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 7bit Sender: owner-traveller(a)Phaser.ShowCase.MPGN.COM Reply-To: traveller(a)MPGN.COM Tue, 21 Oct 1997 00:08:58 +1300 Andrew Moffatt-Vallance wrote: > To crib a plot line from ST:TNG (who cribed it from Niven I think). Assuming > that the aliens have a reasonable biotech, why not encode it in the DNA > sequences of some local life forms. Sharks would be a good bet, or jellyfish. > Remember something like 90% of any DNA sequence is just waste space. I actually used this idea maybe ten adventures back in my current campaign, although I got the idea myself and thought it was pretty original. Well, that just goes to show... The setup was a little different. A psionic noble (yes, I'm playing off the Psionic Knights campaign) was persued during the psionic suppressions, and encoded the whereabouts of his (psionic) noble's order's tresuary in plasmid rings in his blood, leaving behind him a subtle clue for friendly successors to pick up. The player characters found his buried body, dug it up and analyzed what was left of his deteriorated blood. The party's (NPC) doctor found the following obviously artificial encoding as part of more 'natural' DNA: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTT AAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTT AAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTTAAACCCGGGTTT AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT AAAAACAAGAATACAACCACGACTAGAAGCAGGAGTATAATCATGATT CAACACCAGCATCCACCCCCGCCTCGACGCCGGCGTCTACTCCTGCTT GAAGACGAGGATGCAGCCGCGAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ATAAGGCGTCTAATGGCAAAGAAGAAGACAGCACTACGCCAGCCTGAA AGGCGTATCGCACCGAGGCGTATACACATGCTAGCCGCAGAAAGGCGT CGTAGGCCTCTCGCAAGGATAATACGACGTATCCAGCCTCAAGCACTC CGAGCACAGCCGCGCATGCGTCAGAGGCCCGCAATGATCCAGATACTC GCAAGCACTGCCGCACGCAGGCTGCCCAGGCTAGCACGAATTATTCAG ATACAGAGGCCCGCACGTATGATACGACAACCTCAGCTCCAGCGACCT GCACGAATTGCACTCCACATGGCACGACGTATCATGCGTGCACGAATT GCACTCCACATGGCAGAACACCAGCTCATGGCACTACTCAGGCGTGCC GCAAGGCTCGCACTCCACATGGCAATCATGAGGATCGCACCGAGGCCT CTAGCAATTCAGCCTCAAATGCGTGCCGCAAGTCCCAGGATACCAGCA AGTCGAGACGCACTCCACCGTCGAGAACCTGCACAGCCTGCACTCCAC ATGGCAGAAATGCCCCCCGCCAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA I explained to the players that 'A' was for Adenine, 'C' for Cytocine, 'G' for Guanine, and 'T' for Tymine (the for possible DNA bases) and let them loose without any further help at all. They actually broke the code, and it was very satisfying for both them and me. Here's a little challenge for you all: Can any of you guys break the code? Mark Seemann mark(a)dk-online.dk http://www2.dk-online.dk/users/mark_seemann

1 0

Re: SMTP Encryption Extension
by Ariel Glenn 17 Dec '03

17 Dec '03

>Well, what are we really concerned about? Not Web traffic - although your >web surfing history is private information, the data itself is by nature >public and encrypting it is kinda pointless. Not at all! Most of my time is spent trying to keep 'restricted data' from being scooped by the wrong people... from the Web. We have licensed data, students' private data, surveys and voting (the results of which should be available only in certain formats and then only to certain people), etc. etc... So data kept on the filesystem has to be protected and it has to be encrypted when it is sent out to the browsing (legitimate) user. Nice try... Ariel Glenn ariel(a)columbia.edu

2 1