December 2003 - cypherpunks-legacy

Numbers don't lie...
by A. Padgett Peterson P.E. Information Security 17 Dec '03

17 Dec '03

Have finally gotten around to reading the Jersey Seven paper on keylengths. Is rather amazing since if anything they are being conservative with some of their numbers - are using 30 Mhz for the FPGA where I have been using 40 & using 200 Mhz for ASICs where I would use 300 (year and a half ago I used 150mhz based on what I knew *had* been built, not what I knew X-ray lithography is capable of. In their figures, they do seem to gloss over a couple of minor points: The most compelling to me is "how do you know when you broke it ?". Bruce has always used the "known plaintext" approach, however using modern techniques for messaging, *every* message has a different session key, negotiated using assymetric keying so the only message that will be broken is one that you already have - not terribly helpful. The second point is that their scalability seems to be based on costs per chip alone, cost for which the engineering cost has been recovered and for which the yeild is significant, hardly givens when you are talking pushing the state of the art, given this 200 Mhz Pentiums would be U$10.00 also (well, maybe U$25.00). Finally, no cost is allocated to the sustem required to program/evaluate the ponderings of these 100's of ASICs. As anyone who has ever programmed a massively parallel computer (which is what they are talking about in their brute force machine, it is the boundary communications that kill you. True, each machine could operate on a specific portion of the keyspace with bits fixed as a function of its address, but each will need to be loaded with the plaintext to match and have some means to communicate success. You also have to consider that dividing the keyspace may result in some processors running slower than others due to the values used. Another minor problem in parallel processors. The cost is given of U$300,000 to build a SOA machine that could break DES in 3 hours. Using the 200 Mhz (2*10^8) figure and assuming 1 trial per clock (being nice), a single chip will test 2.2*10^12 keys in that period. 2^55 is otoa 3.6*10^16 so will require 16,680 thingies running in parallel. If they can get the chips for U$10, they will be able to allocate another whole U$10.00 per chip to the support structure and basic programming to stay inside the budget. Since this will hardly be a production process, I suspect that the cost might be a tad higher. Now often banking and EDI (as opposed to EC) does make the mistake of using the same key for more than one message. Similarly a firewall<>firewall connection might beep a single keyed channel open for multiple sessions. This would be at risk. But for individual messages. The paper does make an appropriate observation: the cost is essentially fixed per key (scaling is not perfect but can ignore that for the moment - has to do with why Crays are circular and Grace's "nanosecond"). This means that the strength of cryptography should be appropriate to the value of the information protected. If less than U$10,000, the message is individually encrypted, and has value only today, then DES is probably "good enough". Strategic information of higher value arguably needs "more" but how much ? 64 bits is 256 times stronger than DES. This would indicate effective security up to say U$2.5 million. More is better but I would not be quite so alarmist nor would I dismiss the cost of engineering. Non-trivial. Do agree that 40 bits is the same as no crypto at all (reminds me of Bob Clampett's "No Bikini Atoll" but is another hobby entirely). Still, at what point is it simply easier/cheaper to buy someone who knows the secret ? Warmly, Padgett ps calculation made with a Sharp EL-5806 "scientific" calculator that is probably older than some readers. If I dropped a digit, please let me know.

2 1

Re: Some thoughts on the Chinese Net
by Bill Stewart 17 Dec '03

17 Dec '03

At 05:38 PM 2/14/96 -0500, Perry wrote: >Jon Lasser writes: >> The more complex portion (from my perspective, at any rate) is a >> modification of the standard TCP/IP protocol, requiring that each packet >> be signed by its originating user. This would require lots of software >> modification on the Chinese end, as well as a conversion process at the >> National firewall. > >They could use no stock software, and they would grind every machine >in the country to its knees doing the signatures. RSA signatures >aren't cheap. Could you use IPv6 / IPSP authentication to do the job? You'd obviously need to create network software for the various operating systems, but for most of them it's not a big change and various well-known people are working on implementations :-) You could get by with something cheap like an RSA-signed key used for a MAC with either RC4 or MD5, reducing the problem to one RSA signature per connection plus faster algorithms. For email, that's probably still one signature per mail message, but it's a manageable load... #-- # Thanks; Bill # Bill Stewart, stewarts(a)ix.netcom.com / billstewart(a)attmail.com +1-415-442-2215 # http://www.idiom.com/~wcs Pager +1-408-787-1281 ! Frank Zappa for President !

3 2

Re: PING packets illegal?
by Bill Stewart 17 Dec '03

17 Dec '03

At 03:20 PM 2/14/96 -0500, markm@gak [cute machine name :-] wrote: >-----BEGIN PGP SIGNED MESSAGE----- >> Concerning the ITAR ...... what would happen if some Evil Hacker Dude in, >> say, England, decided to ICMP-ping a host in America? Nothing wrong with >> that ...... but if those ping packets contained little pieces of something >> like PGP ...... would the host being pinged be breaking the law? Would >> all the hosts in the route between that host and the host in England that >> was doing the ping also be breaking the law? > >Exporting encryption to the U.S. from another country is not illegal, only >exporting from the U.S. is. The method of transmissioni is irrelevant. It >does not matter if TCP packets or ICMP-ping packets are used to transmit the >data. You missed the fun part of his post - it's that ping packets return the data they were pinged with, so the US-end host is re-exporting components of PGP. >From a legal perspective, it's tough to assert that the US user had scienter, given that it pings scarcely reach the machine's consciousness, much less the human users', since they're handled by ICMP rather than by a user-space TCP or UDP socket. (Obviously, if there's a sniffer around this is slightly different.) Is it possible to send out forged ping packets, pinging machine B with a From address of C (fake) instead of A (real), so that Alice can talk to China via Bob? If so, it might be an interesting method for traversing some firewalls, and also (if you write a ping-collector program) for back-channel communications. If you want to really abuse the protocols, 53 bytes probably fits into the 64 you can send in a ping, so you could implement ATM-over-ICMP :-) #-- # Thanks; Bill # Bill Stewart, stewarts(a)ix.netcom.com / billstewart(a)attmail.com +1-415-442-2215 # http://www.idiom.com/~wcs Pager +1-408-787-1281 ! Frank Zappa for President !

3 2

Re: Patents suck
by jf_avon＠citenet.net 17 Dec '03

17 Dec '03

>I take some disagreement with that. > >With patents, there is a problem of large companies owning them yet >doing nothing with them except suing other companies or individuals. If you reject that possibility, you imply that the result of your work for yourself might not be your own property. It does not matter if the idea patented was originated be the patent holder of was purchased by the patent holder. Money is equivalent to personnal work. And the property rights *are* fundamentals (even if not implemented in Biiieauuuutifull Canada...). You can not have your cake and eat it too... >Patents would be better if there was a good-faith attempt on the >part of the holder to "use it or lose it". Somebody sitting on a >patent and doing nothing with it deserves to lose it after a number >of years. AFAIK, such clause already exists in Canada. But again, I am not a layer. JFA **** NEW PGP 2.6.2 KEY ********* This key is actually suspended, as of Feb, 16 1996, was never distributed, and might be subject to deletion. Sorry for the trouble my mis-management might have caused. 2048 bits Key ID:24201BA1 1996/02/13 Jean-Francois Avon <jf_avon(a)citenet.net> Key fingerprint = 23 B6 24 31 86 67 FB 35 C7 A7 AF 12 A1 61 E9 3D **** OLD KEY: DO NOT USE ANYMORE UNLESS FOR VERIFYING SIGNATURES **** 1024 bits Key ID:57214AED 1995/10/04 Jean-Francois Avon <jf_avon(a)citenet.net> Key fingerprint = 84 96 76 AE EB 7C AB 15 88 47 87 B0 18 31 74 9F

1 0

Off-topic, but pertinent...
by Ed Carp 17 Dec '03

17 Dec '03

---------- Forwarded message ---------- Date: Sun, 18 Feb 1996 01:00:06 -0800 From: Sun Angel Innovations <webmaster(a)sun-angel.com> To: quotes(a)sun-angel.com Subject: Daily Quote for Sunday, 18 February 1996 If you resist reading what you disagree with, how will you ever acquire deeper insights into what you believe? The things most worth reading are precisely those that challenge our convictions. unknown -- Sun Angel Innovations | http://www.sun-angel.com/ | info(a)sun-angel.com

1 0

Re: A Cyberspace Independence Refutation
by Duncan Frissell 17 Dec '03

17 Dec '03

At 06:13 AM 2/16/96 -0500, lmccarth(a)cs.umass.edu wrote: >> I'm waiting. Then I'll have to call all the way to Montreal to log on. > >So much for the-net-as-I-know-it, where people don't have to call outside >the country just to log in to the net. Most of the people I want on the net >are very unlikely to do this. But what we think of as "phone calls" are likely to be digital and flat rate as well so calling distant points won't involve much of a hit. >I'd be interested to see the documentation of the number of peasants in >the U.S. (or elsewhere) who have done anything like this. Documentation of >the number of peasants who could manage the technical details would also >be interesting. Actually, it only takes a million or so out of the world population to make restrictions impossible. That will certainly be achievable. Configuration need not be difficult if the technically aware produce easy installation software and I think this is being done. In any case, once Windows 96/Windows NT is stable enough with genuine multithreading we'll be able to do a nice background TCP/IP setup with a point and click interface. If the capability to do something people want to do (communicate freely) exists, it *will* be used. Enforcement doesn't work. The Great Enemy would need to remove the capability. But they are not doing that. They are encouraging the move towards a more communications rich environment not towards a lesser one. >And of course, all peasants have plenty of disposable income to spend on >long-distance phone charges.... No more long distance. Haven't you heard. The "production cost" of a New York to London call is currently less than 2 cents a minute (most of that for billing) AT&T charges about 50-100 cents a minute. That sort of markup can't survive. >Duncan Frissell writes: >> We (some of we) don't want the housing or the school funding either. I >> certainly consider slave schools to be the most common form of child abuse >> in the world today. > >That's nice, but are you seriously claiming that the portion of the average >set of voters in a Congressional district that strongly agrees with you on >those issues matters a whit in a Congressional election ? No. But I do claim that their view doesn't mean much in an age in which politics is being replaced by markets. Look. Coercion-based systems like government depend on a power balance tipped far in their direction. They start to break down as individuals and small groups gain levels of power that are more equal to theirs. If we can overturn one of their commands with five minutes of keyboarding, that command can't stand. The stability of past systems was based on the fact that 90% of the population couldn't do anything no matter what happened. They had to stay where they were and grow food or they would starve. It's not hard to rule people in that situation. We aren't in that situation any more. We can move and communicate and buy and sell and the government can't do much about most of it. They depend on our acquiescence and the freedom of communication we have weakens their hold on that acquiescence. DCF

1 0

Re: True random numbers
by James M. Cobb 17 Dec '03

17 Dec '03

Friend, (1) The Centre de Recherches Mathematique is hosting a year-long program in combinatorics and group theory in 1996-1997. The year will be organized around a number of workshops spread throughout the year. Among the workshops: WORKSHOP ON PSEUDORANDOM NUMBER GENERATION 06 03 / 28 96 The CRC's at the University of Montreal. Details: ACTIVITIES(a)CRM.UMontreal.CA or http://www.CRM.UMontreal.CA (2) If you'd like to read RFC 1750, "Randomness Recommendations for Security," but you're too busy to ftp, email mailserv(a)ds.internic net and in the body of the message include the command document-by-name rfc1750 In due time it will arrive in 2 parts. At the end of the 2d part: References [ASYMMETRIC] - Secure Communications and Asymmetric Cryptosystems, edited by Gustavus J. Simmons, AAAS Selected Symposium 69, Westview Press, Inc. [BBS] - A Simple Unpredictable Pseudo-Random Number Generator, SIAM Journal on Computing, v. 15, n. 2, 1986, L. Blum, M. Blum, & M. Shub. [BRILLINGER] - Time Series: Data Analysis and Theory, Holden-Day, 1981, David Brillinger. [CRC] - C.R.C. Standard Mathematical Tables, Chemical Rubber Publishing Company. [CRYPTO1] - Cryptography: A Primer, A Wiley-Interscience Publication, John Wiley & Sons, 1981, Alan G. Konheim. [CRYPTO2] - Cryptography: A New Dimension in Computer Data Security, A Wiley-Interscience Publication, John Wiley & Sons, 1982, Carl H. Meyer & Stephen M. Matyas. [CRYPTO3] - Applied Cryptography: Protocols, Algorithms, and Source Code in C, John Wiley & Sons, 1994, Bruce Schneier. [DAVIS] - Cryptographic Randomness from Air Turbulence in Disk Drives, Advances in Cryptology - Crypto '94, Springer-Verlag Lecture Notes in Computer Science #839, 1984, Don Davis, Ross Ihaka, and Philip Fenstermacher. [DES] - Data Encryption Standard, United States of America, Department of Commerce, National Institute of Standards and Technology, Federal Information Processing Standard (FIPS) 46-1. - Data Encryption Algorithm, American National Standards Institute, ANSI X3.92-1981. (See also FIPS 112, Password Usage, which includes FORTRAN code for performing DES.) [DES MODES] - DES Modes of Operation, United States of America, Department of Commerce, National Institute of Standards and Technology, Federal Information Processing Standard (FIPS) 81. - Data Encryption Algorithm - Modes of Operation, American National Standards Institute, ANSI X3.106-1983. [D-H] - New Directions in Cryptography, IEEE Transactions on Information Technology, November, 1976, Whitfield Diffie and Martin E. Hellman. [DoD] - Password Management Guideline, United States of America, Department of Defense, Computer Security Center, CSC-STD-002-85. (See also FIPS 112, Password Usage, which incorporates CSC-STD-002-85 as one of its appendices.) [GIFFORD] - Natural Random Number, MIT/LCS/TM-371, September 1988, David K. Gifford [KNUTH] - The Art of Computer Programming, Volume 2: Seminumerical Algorithms, Chapter 3: Random Numbers. Addison Wesley Publishing Company, Second Edition 1982, Donald E. Knuth. [KRAWCZYK] - How to Predict Congruential Generators, Journal of Algorithms, V. 13, N. 4, December 1992, H. Krawczyk [MD2] - The MD2 Message-Digest Algorithm, RFC1319, April 1992, B. Kaliski [MD4] - The MD4 Message-Digest Algorithm, RFC1320, April 1992, R. Rivest [MD5] - The MD5 Message-Digest Algorithm, RFC1321, April 1992, R. Rivest [PEM] - RFCs 1421 through 1424: - RFC 1424, Privacy Enhancement for Internet Electronic Mail: Part IV: Key Certification and Related Services, 02/10/1993, B. Kaliski - RFC 1423, Privacy Enhancement for Internet Electronic Mail: Part III: Algorithms, Modes, and Identifiers, 02/10/1993, D. Balenson - RFC 1422, Privacy Enhancement for Internet Electronic Mail: Part II: Certificate-Based Key Management, 02/10/1993, S. Kent - RFC 1421, Privacy Enhancement for Internet Electronic Mail: Part I: Message Encryption and Authentication Procedures, 02/10/1993, J. Linn [SHANNON] - The Mathematical Theory of Communication, University of Illinois Press, 1963, Claude E. Shannon. (originally from: Bell System Technical Journal, July and October 1948) [SHIFT1] - Shift Register Sequences, Aegean Park Press, Revised Edition 1982, Solomon W. Golomb. [SHIFT2] - Cryptanalysis of Shift-Register Generated Stream Cypher Systems, Aegean Park Press, 1984, Wayne G. Barker. [SHS] - Secure Hash Standard, United States of American, National Institute of Science and Technology, Federal Information Processing Standard (FIPS) 180, April 1993. [STERN] - Secret Linear Congruential Generators are not Cryptograhically Secure, Proceedings of IEEE STOC, 1987, J. Stern. [VON NEUMANN] - Various techniques used in connection with random digits, von Neumann's Collected Works, Vol. 5, Pergamon Press, 1963, J. von Neumann. Of course you'd get the 2d edition of Schneier's Applied Cryptography. Something a little different at the introductory level: J C G Lesurf Physics and Astronomy Department University of St Andrews Scotland Information and Measurement Institute of Physics Publishing US Editorial Office The Public Ledger Building Suite 1035 Independence Square Philadelphia PA 19106 1995 ix + 243 ISBN: 0 7503 0308 5 Cordially, Jim

2 2

Re: CDA Yes Votes; Collection
by Duncan Frissell 17 Dec '03

17 Dec '03

At 08:54 PM 2/16/96 -0800, Simon Spero wrote: >So, if the US were to end up with a President Buchanan elected by 25% of >all eligible voters, would you advocate seeking exile, or armed rebellion? Well, few rebelled or left when William Jefferson Blythe Clinton won with 23% of the eligible vote. DCF

1 0

Re: A Cyberspace Independence Refutation
by frantz＠netcom.com 17 Dec '03

17 Dec '03

At 2:56 PM 2/18/96 -0500, Duncan Frissell wrote: >At 06:13 AM 2/16/96 -0500, lmccarth(a)cs.umass.edu wrote: >>I'd be interested to see the documentation of the number of peasants in >>the U.S. (or elsewhere) who have done anything like this. Documentation of >>the number of peasants who could manage the technical details would also >>be interesting. > >Actually, it only takes a million or so out of the world population to make >restrictions impossible. That will certainly be achievable. ... My wife attended the World Women's Conference in Hai Rou, China (as staff supporting their Apple computers). She reports that the "killer application" demonstrated there was email. Women in extreemly poor countries of the world were interested in communicating with each other about solving local problems (e.g. Clean water supplies). The demand is there. These people are not stupid. They can learn. I expect to see the village email computer build on "obsolete" donated machines start to become a force in the next century, the same way the village TV and cassette player have played a role in the last decade. Regards - Bill

1 0

[NOISE] Re: CDA Yes Votes; Collection
by tbyfield＠panix.com 17 Dec '03

17 Dec '03

At 3:40 PM 2/18/96, Duncan Frissell wrote: >Well, few rebelled or left when William Jefferson Blythe Clinton won with >23% of the eligible vote. This fact seems to pique you, Duncan, as though it were somehow unjust. If you feel so strongly, maybe you should get out and organize those oceans of people who're waiting to think and vote just like you do. Or is "organizing" too gauche for your finer sensibilities? I'm no fan of the man myself, but he _did_ win. Don't like it? Change it. Ted

1 0

Re: CDA outside US (Including Indian Reservations)
by Robert A. Rosenberg 17 Dec '03

17 Dec '03

At 19:08 2/17/96, Ed Carp wrote: >Another problem - if you ever want to get into the US, you can kiss that >chance goodbye. They might not even let you into the country as a >visitor. Stupid. A fair number of Western countries have laws that say, >in effect, that if you do something in your country that isn't illegal in >your country but is in country X, then country X can bar you entry or PR >status or citizenship based on the fact that is *is* a crome in country X. Of course there are other Western Countries that will let you in with the intent of Arresting you (and possibly extradite you to a 3rd Country since you are not Guilty of anything in the Extraditing Country except for being on the 3rd Country's "Wanted List". There was a big stink a while ago about someone being shipped to Germany on one of these International Pick-Up Warrants.

1 0

Gustave Solomon
by John Young 17 Dec '03

17 Dec '03

Mathematician Gustave Solomon died on January 31 in Los Angeles. He was 65. Dr. Solomon was a co-inventor with Irving S. Reed of the Reed-Solomon codes, which have come into increasingly widespread use as a way of combatting the inevitable errors that occur in the transmission and storage of information. He did early work concerning the algebraic theory of error-correcting codes, and, with H. F. Mattson, was co-author of the powerful tool for analyzing such codes known as the Mattson-Solomon polynomial. His other interests included composing popular songs and folksongs and teaching voice and movement. Excerpted from NYT obituary, February 18, 1996.

1 0

Re: Science News - article on Quantum Crypto
by jim bell 17 Dec '03

17 Dec '03

-----BEGIN PGP SIGNED MESSAGE----- At 01:18 PM 2/18/96 -0500, Alexandra Griffin wrote: >Bob writes: > >> Does anyone know if the new in-line optical amplifiers (not switches!) have >> any effect on quantum crypto messages? > >Yes, any active devices in your communications path would be unable to >function without making some kind of classical measurement on the >photons involved (e.g. measuring phase relative to a definite test >angle, if phase is what's being modulated), thereby collapsing the >wavefunction and spoiling any special properties afforded by being >able to send photons down the line without "looking at them." Optical >repeaters have to pass your signal through an intermediate electronic >stage anyway, since we have no purely optical valve/transistor >equivalents (bosons don't interact with each other at all). I love to be picky about such things. Yes, I think bosons _DO_ interact with each other. Before all you physics nerds flame me, hear me out: Photons, while they have no "rest mass" do indeed "gravitate" (they are energy, recall?). In a reference I can no longer find in my 1970 Encyclopedia Brittanica, it stated that a cubic mile of sunshine "weighs" 1/100,000,000 of a milligram. From another source (or maybe the same one?) it stated that the photon "weight" in a cubic centimeter of volume at the core of a star such as our sun (or at the core of a nuclear explosion) is about 1 gram per cubic centimeter. Thus, presumably photons self-gravitate, and thus, SOME bosons "interact," although admittedly this kind of interaction is a few dozen orders of magnitude lower than what you probably intended when you said "Bosons don't interact with each other at all." Jim Bell jimbell(a)pacifier.com Klaatu Burada Nikto -----BEGIN PGP SIGNATURE----- Version: 2.6.2 iQCVAwUBMSeY6fqHVDBboB2dAQG7XwQAoGeWJgkUf2Ton5ptuAgps23RN1YVrdS8 MB0t9DIRrmCqNlFOf8c5b3I9ljxpY0JvEMyWG0LYVqp6+ZYBfBwaSEQ9YGI+uzRJ vDIWg/83sBlHDraNiV5f6VBjZNExgvk2N4j1FIploB0SFOBEH3W7ymVa6Z/IZ6fs kYaIKiXp+ns= =YPqX -----END PGP SIGNATURE-----

1 0

Re: Science News - article on Quantum Crypto
by Sherry Mayo 17 Dec '03

17 Dec '03

> > Bob writes: > > > Does anyone know if the new in-line optical amplifiers (not switches!) have > > any effect on quantum crypto messages? > > Yes, any active devices in your communications path would be unable to > function without making some kind of classical measurement on the > photons involved (e.g. measuring phase relative to a definite test > angle, if phase is what's being modulated), thereby collapsing the > wavefunction and spoiling any special properties afforded by being > able to send photons down the line without "looking at them." Optical > repeaters have to pass your signal through an intermediate electronic > stage anyway, since we have no purely optical valve/transistor > equivalents (bosons don't interact with each other at all). I am not sure this is correct. In-line optical amplifiers work by stimulated emission like a laser rod. There is no intermediate electronic stage. The amplifier is a section of fibre that is doped with a rare earth element. The rare earth atoms are boosted into a metastable high energy state using a power source around the fibre. Passing signals (photons) stimulate the decays of the metastable states releasing more photons and boosting the signal. I am not sure what the effect of this on the polarisation characteristics of the signal is but my *hunch* is that the polarisation characteristics would be preserved in the amplified signal. Sherry ps Any laser physicists in the house?

1 0

Re: Ben T. Moore "Mr. Anonymous"
by Duncan Frissell 17 Dec '03

17 Dec '03

At 09:33 PM 2/14/96 -0800, hochiminh(a)alpha.c2.org wrote: >So while you are off being a cool anonymous dude the rest of us are paying for >the AFDC you ex-wife has to use to feed the kids. No individual is responsible for the fact that AFDC exists and steals wealth from others. The government and its supporters are responsible for that crime. >This is a violation of Indiana Code but breaking the law is of no concern to you, huh? Hardly ever prosecuted. In addition, if you use a mail drop for a DMV address and the authorities ever "call" you on it, you can use the Homeless Defense. As far as I know, the homeless have the right to drive. Also, if your license/registration is in a jurisdiction other than the one in which you find yourself, your "lies" to the foreign jurisdiction do not violate local law. >This [opening a mail drop in a false name] is a violation of Indiana and >Federal Laws depending on how they are used. Has never been prosecuted. Very hard to prove in any case since the mailbox clerk is unlikely to remember the person who opened the box account and if you are really worried, you can just add a second phony name to the first name without any false ID having to be presented. You can then collect mail under the second name and ignore the name in which the account was opened. >Another violation of Indiana Code [opening utility accounts in false names]. I doubt that if there is no intent to defraud (hide bad credit for example). If you can later prove that your credit was good and the account would have been opened in any case, then there is no misrepresentation of a material fact and you can fall back on the common law right to call yourself by any name you choose. No prosecutions in any case. It never ceases to amaze me that people invoke never used laws to try and control the behavior of others. Did you know that sodomy is illegal in (circa) 22 states? Does this reduce the incidence of same. Use it or lose it. DCF

1 0

Re: Science News - article on Quantum Crypto
by tcmay＠got.net 17 Dec '03

17 Dec '03

At 9:28 PM 2/18/96, jim bell wrote: >I love to be picky about such things. Yes, I think bosons _DO_ interact >with each other. Before all you physics nerds flame me, hear me out: I won't "flame you," just correct you. It is well-known that photons are affected by gravitation...from the Mossbauer effect to the bending of light by the sun (seen in eclipses) to the gravitational lensing effects. .... >Thus, presumably photons self-gravitate, and thus, SOME bosons "interact," >although admittedly this kind of interaction is a few dozen orders of >magnitude lower than what you probably intended when you said "Bosons don't >interact with each other at all." What is being referred to is a term of art related to Bose-Einstein statistics (the origin of the term boson, as contrasted to fermions, which are affected by the Pauli Exclusion Principle, while bosons are not). No list relevance that I can see, but then neither do nuclear triggers have anything to do with the list. --Tim May Boycott espionage-enabled software! We got computers, we're tapping phone lines, we know that that ain't allowed. ---------:---------:---------:---------:---------:---------:---------:---- Timothy C. May | Crypto Anarchy: encryption, digital money, tcmay(a)got.net 408-728-0152 | anonymous networks, digital pseudonyms, zero W.A.S.T.E.: Corralitos, CA | knowledge, reputations, information markets, Higher Power: 2^756839 - 1 | black markets, collapse of governments. "National borders aren't even speed bumps on the information superhighway."

1 0

Re: Easy Nuclear Detonator
by E. ALLEN SMITH 17 Dec '03

17 Dec '03

I would have appreciated it if you'd sent this to me privately, or at least didn't enclose my message to you (which was sent in private email). Among other reasons, it is rather off-topic (unless one wants to count it among bomb information available on the net). -Allen From: IN%"jimbell(a)pacifier.com" "jim bell" 19-FEB-1996 00:58:39.66 -----BEGIN PGP SIGNED MESSAGE----- At 10:25 PM 2/18/96 EDT, E. ALLEN SMITH wrote: > I've been kind of busy recently (the reason I haven't responded to >the more recent Assasination Politics stuff), but I'm curious what your method >is for achieving simultaneous explosions. "Multiple very thin flexible hollow tubes (1 mm ID? teflon?) filled with a homogenous liquid explosive (for example, pure nitromethane), length accurately cut to produce the exactly desired delay. Kept separated from each other by foam spacers to avoid inter-fiber detonations. Detonated from a single cap, with an intermediary chamber of liquid explosive to stabilize the shock front, the detonation wave travels along each tube simultaneously at (presumably) identical velocity." It's a race, designed so that the detonation waves reach their targets (the foci) at the same time. If the detonation velocity was, say, 5,000 meters per second, an accuracy of 0.5 millimeter in length would produce a delay accuracy of 100 nanoseconds. Whatcha think? Now where did I put that pit... <G> Jim Bell jimbell(a)pacifier.com Klaatu Burada Nikto -----BEGIN PGP SIGNATURE----- Version: 2.6.2 iQCVAwUBMSgFwvqHVDBboB2dAQGzYAQAksCklKTJ80tr+YuASwzt6KRMVgqivydf wjYP9GL5Bo3HeXxEgOB8Xg6gnO9aOdDxMfMKiR0SdodE4V4kiy2y671jPofNz800 Y0YHzKnLcLuZzvnExGkhtLDQLigqDdNWSdPgFItkJ/5TVXHrEfL7+paOmo2hbYKO 5hbuG7wZ9Hg= =6qoY -----END PGP SIGNATURE-----

1 0

Piracy Bests ITAR
by nobody＠REPLAY.COM 17 Dec '03

17 Dec '03

The Economist, 17 Feb 1995, p. 17. Should foreigners' intellectual property always be protected? [Excerpts] Is it right to expect governments, especially poor ones, to honour new World Trade Organization rules on intellectual property? Some economists have made a good case that slack enforcement of such rules may sometimes do little harm. Local firms benefit by acquiring pirated technology more cheaply than the real thing; consumers acquire affordable high-tech products and close copies of branded goods. Although the original producers of the intellectual property lose out, it is sometimes hard to tell how much. They might anyway have sold nothing in a poor country at rich prices. And provided that counterfeiters make reasonably faithful copies, piracy is free publicity: how many Chinese would know about Microsoft's latest programs, or listen to Michael Jackson's new album, had they not been able to buy illegal imitations? ... It is not always obvious what theft is. Much in patent and copyright law is arbitrary. But who says American copyright law is correct? More to the point, why should China accept America's view of how a drug design, say, should be accorded patent protection? In some cases, the interests of rich and poor countries are clearly at odds: one side has all the property. There seems to be no objective standard to appeal to. Eventually, this may change: as poor countries produce more innovations themselves, their own inventors will demand greater protection. Meanwhile, the lot of many intellectual-property producers will not be a happy one.

2 1

No Subject
by yesim ozben 17 Dec '03

17 Dec '03

Some news from Turkey. Up to now all connections to Internet were established and managed by TR-NET the collaboration of a university (METU) and the the national scientific research center (Tubitak). Recently the phone company opened a tender for this task and I think the same group or some company or foundation they were part of won it. Today I read that they are trying to pass some law for the net to be controlled by a monopoly and the reason is to be able to control things. So it's spreading. Yesim

1 0

Re: patents suck
by nobody＠REPLAY.COM 17 Dec '03

17 Dec '03

jf_avon(a)citenet.net wrote: >>With patents, there is a problem of large companies owning them >>yet oing nothing with them except suing other companies or >>individuals. >If you reject that possibility, you imply that the result of >your work for yourself might not be your own property. It does >not matter if the idea patented was originated be the patent >holder of was purchased by the patent holder. Money is >equivalent to personnal work. Bullshit. Corporations do not work; their employees do. The creativity of employees is sat upon as net worth, but nothing is produced. Money is only worth something if it is circulating in an economy; a corporation only has worth if it produces something. Instead corporations produce nothing. They sit on resources, preventing anyone else from producing, because the current system favors non-production and an inflationary and wasteful economy based on speculation. Economic equivalent of people who sit around and talk but don't get off their asses and do something. >And the property rights *are* fundamentals (even if not No, they are not fundamental anything. They are taken for granted in the modern West as a rationale. It's a nice one, and I don't have too many arguments... except when people claim a false dilemma of either total private property or total socialism. Why not a form of property based on use? If you don't use your property, after a while you cease owning it. It was originally a rationale in Europe and early American colonies because so many people claimed to own land that they never saw, despire the fact that natives and settlers lived there. Extended to patents... corporations do a lot of R but no D, but legally no one else can make use of it either. Unisys didn't market LZW compression and let everyone else use it... then they decided they should have been making losts of mulah and wanted to pull the plug and get royalities. IBM has done negligable production on arithmetic coding, so a lot of independ developers ignore the patents. Similar arguments can be made about PK crypto. >You can not have your cake and eat it too... Huh? What does that have to do with this argument?

1 0

Re: Using lasers to communicate
by jim bell 17 Dec '03

17 Dec '03

-----BEGIN PGP SIGNED MESSAGE----- At 10:44 PM 2/17/96 -0500, SINCLAIR DOUGLAS N wrote: >> If you have a secure link you don't need encryption. Arguably, the >> converse is true; if you have secure encryption you don't need >> a secure link. Isn't the ability to transmit secure data over >> insecure channels one of the primary justifications for encryption? >> > >Of course. My point, though I seem to have failed to state it, >is that encryption is a cheap software thing while laser beams >are expensive, complicated, and still not secure. I tend to agree. But my position is a bit more "middle of the road": We _should_ use laser/LED links, but we should encrypt the link with encryption sufficiently strong (IDEA/1024-bit RSA key) to make interception of the beam pointless. I think what's needed from the IC companies is a chip somewhat analogous to the UARTS (TR1602/AY5-1013) (which were "new" in about the 1975 time frame), but one which maintains one half of a bidirectional link with NSA-proof encryption. It wouldn't matter what the physical medium was, it would "handle it." They'd be given "authority" over link signal amplitude, and would be able to monitor link integrity/error rate to anticipate incipient link failures. (caused by electronic/mechanical failure, growth of vegetation, corrosion, and other items.) (I know, I know, shades of 2001! "Open the pod bay door, Hal!") During periods of low usage, it would occasionally automatically engage in link margin testing, etc, and automatically generate/transmit extremely-long period pseudorandom data to prevent snoopers from doing any sort of traffic-density analysis on the working link. If the chip was given mechanical authority over beam-pointing, the chip could also do auto-align test functions to compensate for misalignment, etc. Alignment would be kept "perfect." While I'm no IC-design expert, considering the fact that chips commonly possess at least 1000 times as many transistors as they did in 1974, they SHOULD be able to implement such a chip easily enough. Lazy bastards. Jim Bell jimbell(a)pacifier.com -----BEGIN PGP SIGNATURE----- Version: 2.6.2 iQCVAwUBMSezPPqHVDBboB2dAQGu1gP+J1t3aagiHVoSE0ETiid2TPYw1wCBxi5H znvWIHbic9VNMnBo1ZkeSiR86Xi/C311CB526vRZnzNyUNuk8vF55MxGY7FRf1sn xGvH0n+b3Y4XR3NsJP0cazLhmDZocjTTjiRDGMSFt4wwLt0SqiLbrxQ/WkcB6ee+ /17ORpzAafk= =klc5 -----END PGP SIGNATURE-----

1 0

Turkey says: "But even the U.S. censors its Net!"
by tcmay＠got.net 17 Dec '03

17 Dec '03

At 10:46 PM 2/18/96, yesim ozben wrote: >Some news from Turkey. Up to now all connections to Internet were >established and managed by TR-NET the collaboration of a university >(METU) and the the national scientific research center (Tubitak). >Recently the phone company opened a tender for this task and I think the >same group or some company or foundation they were part of won it. Today >I read that they are trying to pass some law for the net to be controlled >by a monopoly and the reason is to be able to control things. So it's >spreading. I'm sorry to hear this, but it's predictable. One of the worst aspects of the Communications Decency Act is that it undermines criticism of similar acts in other countries. If Germany, Turkey, Singapore, or China censor their computer users and establish controls, critics will be met with a pointer to the U.S. policies. If even the country that spends the most effort bragging about its love of liberty is seen as censoring the Net, then surely it is a reasonable thing to do. (We've seen similar cases in other contexts, where the United States boasts about its free trade policies while forcing Canadians to reduce production, or limits the amount of crops grown, etc. Other examples are readily apparent.) If the U.S. sees the need to control thoughtcrime, so will other countries. --Winston Smith Boycott espionage-enabled software! We got computers, we're tapping phone lines, we know that that ain't allowed. ---------:---------:---------:---------:---------:---------:---------:---- Timothy C. May | Crypto Anarchy: encryption, digital money, tcmay(a)got.net 408-728-0152 | anonymous networks, digital pseudonyms, zero W.A.S.T.E.: Corralitos, CA | knowledge, reputations, information markets, Higher Power: 2^756839 - 1 | black markets, collapse of governments. "National borders aren't even speed bumps on the information superhighway."

1 0

Re: True democracy in America.
by Sean Morgan 17 Dec '03

17 Dec '03

Isaac Hopkins <Isaac.C.Hopkins-1(a)tc.umn.edu> wrote: >A truly Democratic society is only feasible when you have an educated >society that can act outside of their own self interest [...] A democracy >is just the tyranny of the majority. Democracy works because it recognizes the power of a majority. If a leader's policies are at odds with the will of the majority, sooner or later they will rise up against him/her. If you will allow me to throw a cliche back at your "tyranny of the majority", how about "might makes right"? Or as Churchill said (more or less), "Democracy is the worst possible form of government, except for all the others." Notice that "might makes right" does not imply that any education is necessary. -------------------------------+----------------------------------------- Sean Morgan (sean(a)lucifer.com) | Let me tell you a few bits about myself: | CACTTGCCGGGTAACACTCCATGAAATTCTTCTCAGCC http://www.lucifer.com/~sean/ | AGGTGTCGACGCTAGGATCAACCTTTAAGTGAACT...

1 0

Re: Science News - article on Quantum Crypto
by jim bell 17 Dec '03

17 Dec '03

-----BEGIN PGP SIGNED MESSAGE----- At 04:01 PM 2/18/96 -0800, Timothy C. May wrote: >At 9:28 PM 2/18/96, jim bell wrote: > >>I love to be picky about such things. Yes, I think bosons _DO_ interact >>with each other. Before all you physics nerds flame me, hear me out: > >I won't "flame you," just correct you. Hmmmm. Last thing I saw, you claimed you put me in your "killfile." Glad to see I'm off. (This makes me wonder why...) Hope I don't do anything else to offend you. B^) >It is well-known that photons are affected by gravitation...from the >Mossbauer effect Hey, you're a sharp guy! Not too many people are aware of the Mossbauer effect. I'll bet you read the same Scientific American article I did, decades ago. Here's a question: How hard is it to make a gamma detector? I'd like to experiment with the Mossbauer effect, but aside from the difficulty of obtaining the radioactive nuclides, I don't know to make a crystal detector. And is that the best an amateur could do? > to the bending of light by the sun (seen in eclipses) to >the gravitational lensing effects. > >.... >>Thus, presumably photons self-gravitate, and thus, SOME bosons "interact," >>although admittedly this kind of interaction is a few dozen orders of >>magnitude lower than what you probably intended when you said "Bosons don't >>interact with each other at all." > >What is being referred to is a term of art related to Bose-Einstein >statistics (the origin of the term boson, as contrasted to fermions, which >are affected by the Pauli Exclusion Principle, while bosons are not). Yes, yes, yes, I know this stuff. But my pickiness was based on the fact that the term "interact" can vary over many orders of magnitude. For example, as I recall the ratio of the electrical repulsion between two protons exceeds the gravitational attraction by a factor of about 10**40. I just object to the use of the term "interact" in a cavalier way, as if quantum mechanical "interaction" was the only kind of interaction that "mattered." (no pun intended...well, maybe just a little.) >No list relevance that I can see, but then neither do nuclear triggers have >anything to do with the list. Okay, maybe not, but my idea is substantially better than anything I've heard published in the open lay press. I just heard from a friend that even that hack Clancy used krytrons and capacitors; my system would use _trivial_ components to do the timing. Jim Bell, N7IJS jimbell(a)pacifier.com Klaatu Burada Nikto -----BEGIN PGP SIGNATURE----- Version: 2.6.2 iQCVAwUBMSe8AfqHVDBboB2dAQFUQwP/fcsCsqydcEFdxnBqWuFeFrqoumUtg5NR 5SSTPs1dX7SZ2A1eBNo1Up9JodqShnJtce464rrW7kleX5bHSGG5mY327D1X9+Nw O/UcI7yfKdHidUK7Z7YUn5zeBnZzVqsTStXPX4SECg8bfvo9Ey/OjEQ/bVi0Qi4C fiwJD8skIE4= =DaGm -----END PGP SIGNATURE-----

1 0

Re: CDA outside US (Including Indian Reservations)
by Sean Morgan 17 Dec '03

17 Dec '03

Ed Carp <erc(a)dal1820.computek.net> wrote: >Another problem - if you ever want to get into the US, you can kiss that >chance goodbye. They might not even let you into the country as a >visitor. Stupid. This is not an idle threat. When Pierre Trudeau was elected prime minister of Canada (1969?) there was some scrambling in the US to get him off the _persona non grata_ list. Seems that in his student days he had been busted for trying to kayak from Florida to Cuba. Canadian author Farley Mowatt (sp?) was turned back at the border for imagined pinko associations (best guess was that it was because he had traveled to the USSR to research _Sibir_). Such a blacklisting would really hurt me in my current job. I made about 15 business trips to the US (from Canada) last year. >A fair number of Western countries have laws that say, >in effect, that if you do something in your country that isn't illegal in >your country but is in country X, then country X can bar you entry or PR >status or citizenship based on the fact that is *is* a crome in country X. That makes no sense. "Country Y would pass a law saying that country X may bar you for something country X doesn't like"?? That's unnecessary on two counts: Country Y has no jurisdiction in X, and X doesn't need Y permission anyway. Example, so called "sex tourist" from western countries travel to the far east to have sex with minors. You can't do it back home, but there nothing to stop you from doing it abroad. Or if you want an example closer to home, how about Californians traveling to Nevada to gamble? -------------------------------+----------------------------------------- Sean Morgan (sean(a)lucifer.com) | Let me tell you a few bits about myself: | CACTTGCCGGGTAACACTCCATGAAATTCTTCTCAGCC http://www.lucifer.com/~sean/ | AGGTGTCGACGCTAGGATCAACCTTTAAGTGAACT...

1 0